Transcript

chmp5b-201

ID
ZDB-TSCRIPT-090929-8080
Name
chmp5b-201
Previous Names
  • chmp5-001
  • chmp5b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025331 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025331|OTTDARG00000020293|ZDB-GENE-040426-1374 chmp5b|OTTDARP00000020843 chmp5-001 LG_ CR376779.18 Danio rerio protein_coding KNOWN, 1451 bp
TAGCGCAGCTCTACATTTAGTTGGACACGCCTACGCCTCT
TTATTGAAATCACGTGAATACTGGAGTTCGAAAAGCTCCG
ATCCACTGAATCAAAACAAAAAAGTTCTTAAAGATCTCGA
ATCACTGTGAAGCAGTGTTTCGAACGTGCCAATAACATAG
TTTACCATTTAACCATTAAGTTTTGCTTTAAATGGGTCTT
GGTCTGTGTGAAACATATCTATGTGTGTGAAACCTCTTGG
ACGTCATGACGTCAGTACTTCCGGGTTGCTTTTCAGGCTG
CGTTTTGTTGTCAGGCGGTGAAAGGGAGAGACTGTTTTGT
CTTTTCTTCGTTTTTATTTAAACCCGTTTATTAAAGATAC
TGTCAAGATGAATCGTATCTTCGGACGAGGAAAACCCAAA
GGACCACCGCCGAACCTCACGGACTGTATATCAGGTGTTG
ACTCTCGAGCAGAGTCGGTCGATAAGAAAATAGCCAGGCT
TGATGCCGAACTGATGAAATACAAAGACCAGATGAAGAAA
ATGAGGGACGGCCCATCAAAGAATATGGTGAAACAGAAAG
CAATGCGAGTCCTCAAACAGAAGAGAATGTATGAAGGGCA
GAGAGACCAGTTGATGCAGCAGTCATTTAACATGGAACAA
GCAAACTACACTATCCAGACGCTAAAAGACACCAAGACCA
CGGTGGAGGCAATGAAAATCGGTGCCAAAGAAATGAAAAA
AGCATACAAGAATGTTAAAATTGATCAGATCGAGGATCTG
CAAGACCAGTTGGAGGACATGATGGAAGATGCTAATGAAG
TCCAAGAAGCTCTTAGTCGCAGCTATGGGACACCAGAAAT
TGATGAAGATGACTTGGAAGCAGAGCTGGATGCACTGGGT
GACGAACTCCTTTTGGATGATGACAATTCCTATCTGGACG
AAGCGTCTTCGGCTCCAGCTATACCTGAGGGAGCACCAGG
AGACAGAACCACTAACCGGGATGGAGTACTGGTGGATGAG
TTTGGCCTACCTCAAATTCCAGCTACATAATGACAGCGCT
ACAACTTCCCAAACCCACAAAAGATTTGGACAAATATTTA
AACACACAATCAAAGAGCGGGACAGACCTTCTATATCAAA
ATTGGAACAATCTTTCATATGTTGATCTTTTTCATCCTAT
TTGGTGTAATATTCTTCTGCTTCTTTTTCTCTCAAGGATA
TACACTGGTAGTTGGTTTTCTTTATACTGCAATACTGTCA
TTTATTGAAAGCAAATATTAAAAAAATATATATCTGACAT
TGTTGGAGGATTGCATTGCAATGTAACATTGTGTAATTCT
GTTACAGTTGGTTAAAAACACGCAACAAATTGATGCTATT
TTTGTGAGAACAATGAGAACAGACTGGCTCAGGTAAAAAC
AAATGTGCCTGCTTCATTTTGATAGATACACTAATAAACA
ACCTTTATGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations