Transcript

hmx3a-201

ID
ZDB-TSCRIPT-090929-8017
Name
hmx3a-201
Previous Names
  • hmx3a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000025261 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025261|OTTDARG00000020257|ZDB-GENE-001020-1 hmx3a|OTTDARP00000020786 hmx3-001 LG_ AL773596.12 Danio rerio protein_coding KNOWN, 2121 bp
GCTATTGTACGTGCCCAATCGCCGTATACTTTCTGCATTT
AACTCGGGTGACATTTTTATTTCATCATTAGCATCTGGCG
CCAGACGGTCGCGGTGAGCATCATTTTCACCAAGGAACTC
TCGGAAGATGATCAGCAAGATTAATATTGTTTATCTCGAT
CCGCGTTATTGTCTTTCGTTTTAACGTCAATGCTGACCGT
AAACAACCGCGTTTAAGTTCCCATTGCTGGAAGAGTTTAC
CAAGGACTTTTAAACTGTTTAAAGATTTTCTTTTTTAACG
CGTTTTTAACGATTTATAAATTGTAGTATAAACCCGAATA
TCAAGCCAACATGCCCGAAACAACACAGGATACGTGTGCT
TCAGCGAAAGACTCTCCATTTTTCATTAAAAATCTTCTCA
ATTCTGACAGTAAGCCGTCAAAGCCTAAGCCTATTTTGGC
ACCCACTAAAGCAGGACTTGATGGCAGCTTCTCCCTTTCT
CAGGTTGGGGAAATAAACTTTCCTCGCTTTGAGTTACCCA
CCCAGCGCTTTGCGTTACCGGCTTACCTTGAGCGTGCCTC
GGCGTGGTGGTACCCGTACACACTCAGTGCATCCGCGCAT
CTTCACAGAACAGAAGCAGCACAGAAAGCGAGGGACTCTT
CGCCGACCACAGGCACCGACCGAGATTCCCCCGAGCTTGT
GCTCAAATCAGATCCGGACGCCAAGGACGATGAAGACGAC
AACAAAAGTGGCGACGAGATTGTCCTCGAGGAGAGCGACA
CCGAAGACGGTAAAAAAGAAGGCGGCATAGACGACTGGAA
GAAGAGTGACGACGGCGCTGACAAGAAACCTTGCCGGAAA
AAGAAAACTCGCACGGTGTTCTCGCGGAGTCAGGTGTTCC
AGCTGGAGTCCACCTTCGACATGAAACGCTACCTCAGCAG
CTCGGAGCGCGCGGGCCTTGCTGCCTCCCTTCACCTCACA
GAGACTCAAGTGAAAATCTGGTTTCAGAACCGCAGAAACA
AATGGAAACGTCAGCTGGCCGCAGAGCTGGAGGCCGCCAA
CTTGAGCCACGCAGCAGCACAAAGGATTGTGAGAGTACCC
ATCCTGTATCACGAGAACTCGGCCTCTGAGAGCACCAACA
CAGCGGGCAACGTTCCTGTAAGCCAGCCGCTGCTCACTTT
CCCTCATCCGGTTTACTACTCGCACCCCATCGTCACCTCC
GTGCCCCTCCTCAGACCGGTTTGAGAGGACGACAGATGTC
TTTTTCTATGTAACTATGTAACTAAATTTTACAGAGACTC
GAAAGAGGGAAAGAGAGAAAATGGGAAAATGAAACCAAGA
GACAAAGATATTTTTGTTTAGAAAATACAAAAAAAAAATT
AAAGAAAAGAAAAAAATGTACAAAGACGCACTATCATGCA
TTTGAGCCCGACATTTTTTGTTTTGTTTTACAATTCCTAA
AAATACCCATAAAACTACACATAAATAAGGCTGTTTAGAG
GCCTGTATTTCAAATGTTGATGTTGGTTGGTGGTAAATTT
CTGACTTTGTTTATTCACTTTGTCATTATACAACTACTAC
TAATAATAATATTAATATTATTATTATTATTAATAATAAT
AATAATAATTATTATTATTATTATTATTGTACCTGCTACG
GTTTATCTGTTTATATAACAAATCAACTTGTTCAACTTGT
TGACACGAAAAGTCTTTAATACACACGTTTAAGTTTCTTT
ACAGCACCGAAAACGCGTACCCACAGACAGCCCTGAACAC
GGATGTGCAATACTACTGTGTATGATCTGTATATTTAGAC
AACATTACTATTCTTATTTTAGACACGTTTTCTTACCAAA
CATTTCTTAGGTTAAGAAGTTAACCGTTAAAACGATTTAA
CTGCTTGGTCCCGCGTTCAATAGACAATCATATATCTGAC
AGACATTACAGTTAAACTGAAGACAAAAACACGAAGAATA
AATACTTTTACTTTTATCTATATTATTTACAGATGTATAT
GTACATGTACAGATATAACGAACCAAAAGGAAAGGTGTCA
TTTGTACAGTAACAGATACGTTCTTTTTTACATTGTATTG
CTAAATTCTGTTGTGAAATAAACGAAGACTACTGAAGTCA
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations