Transcript

sema3gb-202

ID
ZDB-TSCRIPT-090929-7944
Name
sema3gb-202
Previous Names
  • sema3gb-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025181 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025181|OTTDARG00000020213|ZDB-GENE-050513-4 sema3gb|OTTDARP00000020727 sema3gb-001 LG_ BX248384.10 Danio rerio protein_coding KNOWN, 2238 bp
ATGATGTCATCTCTGCTTTTCGTCTTGAGTTTGTGTGTCT
GGGGTTGTCATGGCAACACCCGCACAACACCCCGAGTGCA
CCTGTCATACAAAGAGTTACTGGAGACAAAAACCATTCGG
CCGTTTAGTTTCTCCTTCAACACCAGTGACTACAGAATTC
TGCACATGGACCAAGACCAGGGCCGACTTTATCTGGGCAG
TCGTGAATATCTGGTCTCTCTAGACATGCAGAATGTCAAT
AAGGAACCACTTATTATTCACTGGCCGGCGACAACGCAAA
GAAAAGGGGAGTGTAAATTAACTGGCAAAGGAGGACAGGG
AGAGTGTGCTAACTTTGTCCGTCTGATTGAGCCGTGGAAC
AGGACTCACCTGTACACCTGCGGCACTGGGGCTTACAAAC
CCATCTGCACCTTCATCAACAGAGGCTGGAGAGCTGAGGA
ATACCTCTTCCGGCTGGTTCCTGGTTATGTGGACTCTGGA
AAAGGAAAGTCTCCTTATGATCCCCGGCAGGAGAACGCAG
CAGCTCTGATCAATGGGAACCTGTATTCTGGGGTGCATGT
GGACTTCATGGGTACAGATCCAGCCATCTTCCGAACCTTA
GGAGACCGTCCCGCTGTCAGAACAGAGCAGTATGACTCCC
GATGGCTGAACGAGCCAGTTTTCATAAAAATCCAGAAGAT
TCCAGACAGTGCAGAGAAGAACGATGACAAGCTTTACTTC
TTCTTTCGGGAGAAGAGTCTGGATGCGTCAGGAGGCAGCG
CTCCGAGTGTGCTTGCTAGAGTCGGACGGGTCTGTCTGAA
TGATGATGGAGGTCAGAGGTCACTGGTGAATAAGTGGACG
ACGTTCCTCAAAGCTCGGCTGGTCTGTTCTGTGATCGGTG
CAGATGGTGTGGAGACCTACTTTGATGAACTGAGGGATGT
TTTCATCCAGAGGACCCATGATGAACGAAACCCCATTGTG
TATGCAGTCTTCTCCACAGCTGGCTCAGTGTTTAAAGGTT
CTGCAGTTTGTGTTTACTCAATGTCTGACATCAGAAATGT
CTTCAATGGGCCCTTCTCACATAAACATGGCCACAACTAC
CAGTGGACTCCTTACACTGGCAAAATCCCTTATCCTCGGC
CAGGGACTTGTCCCGGAGGAACTTTCACCCCTGATCTCCA
CACCACTAAAGCCTTCTCAGACGAGGCTGTAAACTTTGTC
CGTGCCCATCCGCTGATGTACCAACCTATATATCCCATAC
ACAAGCGCCCCCTGGTGGTCAGGACTGGAGTCGACTACCG
TTTCACCACCATTGCTGTTGATCTGGTGGACGCTGTGGAT
GGAAGATACGAGGTGCTCTTTCTGGGCACAGATCGTGGAA
CAGTTCAGAAGGTGATTGTCTTACCAAAAGACATCAGCAC
AACAGAAGAGCTCATATTGGAAGAGGTGGAAGTTTTTAAG
ACTCCAGCAGCTGTCAAAACTCTGAAGATTTCTACTAAAA
GGCAACAGTTGTACGTGTCTTCAGAAAGGGGTCTCACCCA
GGTGTCGCTGCACAGGTGCGCCGTCTATGGAAAGGCCTGC
TCTGACTGCTGTCTGGCACGAGACCCCTACTGTGCCTGGG
ATGGAGAGCACTGCTCTGCTTTCACCCCTGCGACCAAGAG
GAGAAGCAGAAGGCAAGATATCAAACATGGAGATCCTCTA
CGGCAGTGCAGAGGATTTAACGCTAAAGAGAAGCGACTGC
GGGAGACAGTGCAGTTCGGGGTGGAGGGGAGCAGCACCTT
CCTGGAGTGTCAGCCAAGGTCTCCACAGGCCACTGTCAAA
TGGCTCTTCCAGAAGGACGGCAGGAGAAAAGCTCTCAGTC
GAGACAAAGAGGTTCTGAAGACGGGTCATGGAATCCTGCT
GAAATCTCTCACCCAATCAGACGCCGGTCTTTACCATTGC
CTAGCAACCGAAAACAACTTTAAGCACACCTTGGCTCGCA
TCTCTCTCCGCATCCTGGACAGAGAGATTGTAGAGGCGCT
GACTGAGTCAGACATCCCGATAGACCCAGAGCACCGGCGC
CACCATTCCCATCAGCACCCTCCACCCCCACCACCACCAC
CTCAAGCCCACCCACCGGCTCTCCCACTCCACCCACAGCC
TGAAGTGCGTCTCATCAACCAGTACTGCCAGTCCTACAGG
CAGCAGATGCAGAGTCAGCCACAAAAAGCCAAACGCAACA
ACCGAAGGCACACAGGAGAACCAGAGGAGGAGCAGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations