Transcript

mapre1a-202

ID
ZDB-TSCRIPT-090929-7940
Name
mapre1a-202
Previous Names
  • mapre1a-002
  • mapre1l-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025177 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025177|OTTDARG00000020211|ZDB-GENE-030131-6067 mapre1a|OTTDARP00000020725 mapre1l-002 LG_ BX005340.7 Danio rerio protein_coding KNOWN, 1196 bp
GTTATCGAGCGTTTGCTGTGGTTTCAGGCTTGCTGCTGCT
GCTGAAGCGGCGCTTTACGAACGACACGCCGGTGAAACGG
AAGATCCCGGCAGAGCGCGGACTTTCATAATTAAATCGGA
AAGAATATCTCTATCAGCTTTAAATCCTCGGTTTTGCCTC
AGTCATGGCTGTGAACGTGTTCTCGACATCGGTGACAAGT
GAAAACCTCAGCCGCCATGACATGCTCACATGGATAAACG
AGTCTTTACAGATGAACCATGCCAAGATCGAGCAGCTGTG
CACAGGTGCTGCTTACTGTCACTTTATGGACATGCTGTTC
CCATCGTGTCTTCCACTGAAGAAAGTCAAGTTCCAGGCCA
AACTCGAGCACGAATACATCCATAACTTCAAACTCCTTCA
AGCCAGTTTTAAAAAGATGGGTGTTAGTAAAATTATTCCT
GTTGATAAGCTTGTGAAGGGCAAGTTTCAGGACAACTTTG
AGTTTGTGCAGTGGTTTAAAAAGTTCTTCGATGCAAACTA
TGATGGGAAGGAATATGATCCGGTGGCCGCTCGACAGGGA
CAAGATATTCCAACCAATCAGAGTCCAGCAGCAGCAGCCA
CGGCTAACAAGGCAAGGAAACCTAGCTCGGCTCCACAGCG
TTCAGCAGCAGCACCTAAATCTACAGCAAAAACATCTCCT
GCGGCAACGAGAGGCACAGGCAGCGGTGATGAAGAAAAAG
GCGCACTTACTCAGATGATAAATGACTTGAAGGCCACCAT
TGCTGACATGGAAAAGGAAAGGGATTTCTACTTCGGCAAG
TTGAGAAACATCGAGCTCATCTGTCAAGAGAAAGAGGGTG
AGGGTGATCCAACACTGCAGAAGATCGTGGATATTCTGTA
CGCCACAGATGAAGGGTTTGTAATCCCGGAAGATGAGGGT
GGTGAACCAGAAGAGTTTTGACCAATCCATGGGGTGACCG
TTTACATTTTTTATTATTAAAGACCCCGCTGGACACTCGA
ATGCACATACTGGCTTATTCCTGCTGTTCTGCTGCACTTG
CCTTCAGTCCATCATTTTGGACTTTGACTTTTGAATGTCT
TTTTATTCAGGGACGTTTCTATACCTTGAATTCTCAGCTT
TTTTTATTGACCATCGAAACAAAACTATTTTTGTGAATGA
AAAAATAAAGTACTTATCAAAGTCTGTTTCTATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations