Transcript

her15.1-202

ID
ZDB-TSCRIPT-090929-7853
Name
her15.1-202
Previous Names
  • her15.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025078 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025078|OTTDARG00000020150|ZDB-GENE-030707-2 her15.1|OTTDARP00000020648 hes5-001 LG_ AL929185.14 Danio rerio protein_coding KNOWN, 1224 bp
GACGCCTCATCCAGCGGCCTCAGAGTGTGGGAAAGCTAAT
CCTGACTGGGACTCATGGCTTTGTAATGCTAATGAGCTCC
TATAAATAGAGCAGCGAGACCCTCATTCCCGACACAAACC
CCTCGCTCTGCTCAGAGAAACAGCATCTCTCCTGAAGAAG
CAATGGCTCCTGCGTATATGACTGAATACTCCAAGCTTTC
CAACAAGGAGAAGCACAAATTGCGAAAGCCAGTGGTGGAA
AAGATGCGCAGAGATCGCATCAACAACTGCATCGAGCAGC
TCAAGTCCATGCTGGAGAAAGAGTTCCAGCAGCAGGATCC
CAACGCCAAGCTGGAGAAAGCCGACATCCTGGAGATGACG
GTGGTTTTCCTCAAGCAGCAGCTGCGGCCCAAGACTCCAC
AGAACGCTCAGATCGAGGGCTACTCGCAGTGCTGGAGGGA
GACCATCAGCTTTCTGTCTGTGGGCTCCGAGGCTGTGGCT
CAACGTCTCCAGCAAGAAGCTCAGAGATCAGCAGCTCCAG
AGCTCACACACACGTCTGAAGCTCCCCATCAGCAGCACAC
ACACATCAAGCAGGAGCCGCGGGCGCACGCTCCGCTCTGG
AGACCCTGGTAGAGACGCTCGAACACTAGATGGTGGTTTA
CCGTCTCTTATGTAGGAGATTCTCCATTTACTATAGTACA
TCACTGATTCACATCGTGTGAAGAAATGAGAGATTCACCA
TGTGAACGCCTCGTCTTCTGCTGATGTTTAGATGTTATGA
TCAGAGGTTTATTAGTGTAGTTTTCCTCATGGATGGACAT
TAATATCAGACTCTGGTAGAGACGCTCGAACACTAGATGG
TGCTTTATAGTCTCTTATCATGTAGGAGATTCTCCATTTA
CTCTAGTCATTTCTTTTGAAAGAGCACGTCACTTATTCTC
ATCGTGTGAAGAAATGAGAGATTCACCATGTGAACGCCTC
GTCTTCTGCTGATGTTATGATATGATCAGAGGTTTATTAT
TGCAACACCTCTGTAGTTTTCCTCATGGATGGACATTATT
TTCTAGACATTTCTTCATGATGAAGAGTCAATGTTGAACT
CCTGTGGAGTTGTGGATTATATGTGATCATTTGTGCATTA
TCAATGCTTTATTGGTGTTTCTTTATATGAAAGATGTGAA
TTTTGACTTATTTATAATATATGATTGTATAATGTTATTG
AAATAAACACATTTTGAACTGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations