Transcript

olig4-201

ID
ZDB-TSCRIPT-090929-7768
Name
olig4-201
Previous Names
  • olig4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024990 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024990|OTTDARG00000020097|ZDB-GENE-030131-3580 olig4|OTTDARP00000020576 olig4-001 LG_ BX936305.18 Danio rerio protein_coding KNOWN, 1078 bp
ACTCATTCCTGATCCCTCACTTCAAGCGGATTGTTTCTGA
GAAGACTTTCAAAGATGGATTCAGACGCGAGCTCCACGTG
CAGTCGCTCCTCCTCGCCAGATCTCACAGTGGACTCTGGC
TTTTTTTCCAACAAGATGTTCCAGGCCTATGGGGAAACGG
TGCAGCAGAAGTCTGAAAAAGGGTTGCAAAACGCCGGGAA
GACTCGCACTCGGGCTGATCTTTCCAAAGACGACCTGCAA
GATCTACGCTTGAAGGTGAACAGCCGTGAGCGCAAACGAA
TGCACGACCTCAACCAGGCTATGGATGGGCTCCGAGAGGT
CATGCCGTATGCTCAGGGACCCTCCGTACGCAAGCTGTCC
AAAATCTCCACCCTGCTGCTCGCCAGAAACTACATCCTCA
TGCTGTCCAGCTCTCTGGAGGAGATGAAGAAGCTAGTGGG
TGATGTGTATGGAGCAAACGCTCAGAGTCACTCCGCAAGA
CGGGTTTTACCACCAACTTCGGCTGCTCCAGCTACACAGT
TACCGCTGCTTTCATTGGCCCCATCACTGCATCCTTTAGT
GGGCAGCACCTCTGCTGTGTCCCACACCACCACAAATGGA
GCTCAAACTCCTCATTCTCCACCCTCCACCGGCTATCTGG
GTTTTCCTGCTCTTCCTACTCTTCTAAAAGACCCTCTTCA
TCTTTCTGGTGGCTACAGGCATTTCCCAGGCATGCCGTGC
CCTTGTTCTTTGTGCCAGCCTCTCCCTGCATCCACAGCCA
GCCTGCACAGCCTCTCCATGGGCAAATGATTCAGGCGAGG
CCCAGGCTTCAGGCCTAAGTAGGCCGAAGTTAAATTTCAG
ACTCTAAAATCATCCAGATGTATTTCTAGATGTTGTGTAT
ACACTGTAAATGTTCTGTACAGAATTCTTCTCATACAATC
TGCTGCTATTTTTATACTGAGGAATGTTTTGTAACTTTTT
TATGTTGAATAGTTTGCTGTTTGAACATATTTACTTGCTT
TTATGTTCTTTGTAGCAAAAATGGCAATGGAAAGAAATGT
ATAGTTTTGTTGTTTAAATTAAACATCTATTATTATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations