Transcript

mecp2-201

ID
ZDB-TSCRIPT-090929-7723
Name
mecp2-201
Previous Names
  • mecp2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024942 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024942|OTTDARG00000020060|ZDB-GENE-030131-7190 mecp2|OTTDARP00000020540 mecp2-001 LG_none BX571687.17,CR352304.6 Danio rerio protein_coding KNOWN, 1684 bp
TTATTTAAATAAAAATGGCCGCCGCAGAGAGCGGAGAGGA
GAGACTAGGTGAGGACAAGAATGAAGACCAGGAGGGCTCA
AAAGACAAGACGCAGAAGCATAAGAAAAGCAAAAAGGAAA
GGCATGATGTGGAAAAACTGGAGACCACAGTCTCTGTTCC
TCCGCCCCCGTCTCTCTTTACGCAGAGGGATGTCGGACAG
CAGGCAGAGGCAGGGAAGTCTGAACCCATTGACCCTGAAG
TTGGAGCTGCTCTCAGCGCTCCAGAATCTTCCGCATCGGC
CAAGCAGCGGCGGTCTGTCATTCGGGACAGAGGCCCAATG
TATGAAGATCCTTCGCTGCCTCAGGGCTGGACACGCAAGC
TGAAACAGCGCAAATCAGGGCGCTCCGCTGGCAAATTTGA
CGTCTACCTTATCAACCCAGAAGGGAAAGCCTTCCGTTCC
AAGGTGGAGCTCATGGCATACTTCCAAAAGGTTGGCGATA
CCATTACAGATCCCAATGACTTTGACTTCACGGTCACGGG
CAGGGGAAGCCCGTCTCGCAGAGAAAAAAGACCGCCAAAA
AAGCCTAAAATGGTCAAACCCTCTGGACGTGGAAGGGGGC
GGCCTAAAGGTAGCGGCAAGGTACGACAGGCTACAGAAGG
GGTGGCGGTGAAACGCGTCATAGAAAAGAGTCCAGGAAAA
CTCTTAGTAAAGATGCCCTTTGTGGCCCCCAAAACTGAAC
CAGGGGCTCCTTTAGGGCAAGCGCCAGTTGCCAAAGCACG
CCGAGGACGTAAGAGGAAATCAGAGCAGGATCCGCCAAGC
ACCCCTAAAAAACGTGGACGCAAGCCAGCAACTGTTTCAC
AGTCAACAGTGGGGACGGGGTCTGCTGCTGCATACGCCGC
TGCAGCCATTCTCACCGCCGAAGCCAAGAAAAAAGCCCTG
AAGGAGTCTTCCGCTAAGCCTGTTCAGGAGAGGGCTCTTC
CTATCAAAAAACGCAAAACCCGAGAGACTTTAGAGGAGCT
GGAGGCATCCACCACCTCAGCGACAGAGACCTTTGAGAAA
CGACTGACTGCATCAACTGTGACCCCTACCGGGGAGGAGG
CAGAAACAGGACAGAAGCCTCACAAGCATCCCAGCCGGAA
GCACAAAGAGGCAGATCCGGGAAGCAGCAGCAGTGGGACG
ACAGCCAGCGGAGTTGCACCGAAGAGTCACAAGAAGAGAG
ATCAGCGAGGGCAGCACTTTAAACACCACCACCACCATCA
TCATCACCACCATCAACACCAACACCTGCAGGCCTCCACA
CCCTCCACCTACACTCCGCAGGCTCACCAGCTCTCCCTGG
GTCACTCCACGCACGGCGGGCTGGAAAACGAGCCGCAGGA
CTTGAGCACCTCCAGGCCCAAAGCGGAGCACGTGGCCTGC
AGGGAGGAGGCCAGAACTGGCAGCTCCTCGAGTAGGGACT
CCCAGAACGCAAGCAAGATGGCTTCCATGACCGTGACGGG
GGAAAGCAAGGAGCTGAGAGACATTGTTCCTCCCTCCGCC
GTCCCGAGGCCGAGTCGAGAGGAAACGGTGGAGTCCCGGA
CACCAGTGAGCGAGCCAGTGAGCTGACTGACTTAGTGACC
GATCGTCAGAGGGTTTATGCGCAAAGAGGCAGCGAGACGA
GCGATTTTTCGTTCTTTTTTACCGAGGAAAAAAGAAAAAG
AGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations