Transcript

sst2-201

ID
ZDB-TSCRIPT-090929-7722
Name
sst2-201
Previous Names
  • sst2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000024941 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024941|OTTDARG00000020059|ZDB-GENE-010219-2 sst2|OTTDARP00000020539 sst2-001 LG_ BX120016.12 Danio rerio protein_coding KNOWN, 539 bp
ACACTTAGGGAGCAGAGTTCTGAGTTAAAGAAGCAGCAGA
AATGGCCTCCTCGCAACTCCACCTGACAGCAACTCTTCTC
TGTCTGGCCATGATGGCGGGCATCATATGTGGACGATCGC
ATATGCTCCTGAACTCTGCACTACAGGCGTCTCGCGGCAC
TTCTGCGGATGAAGAGATACCAGAGAGATACTCGCTTTCT
GAGCTGGAGTGGCTGCTCAGTAACTCGGATCCGGCAGTTT
TCCAGCCTGACAGCTCATCTCTGGGATCGCTACACAGTGG
ACTGGAGCTTATGAGAAGAGATACTAAAGAAGAGAGGAAG
ACCGGCTGCAAAAACTACTTCTGGAAATCCAGAACGGCAT
GCTAAAACTCGAAGTTACCAACATGCTGGCCATCATTTAG
TCTTTCCTTTTCCTGAATCCAACACTCGTCATTTGCTGTC
TTTTGAGTAATTTTAGACATTATCTGTGAAGAGTTTTCCA
CAGTCTCAGTATTATTTTGCTTTGAAGCATTGATTGCTTG
CAATAAACTGAATACAGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations