Transcript

gnat1-201

ID
ZDB-TSCRIPT-090929-7484
Name
gnat1-201
Previous Names
  • gnat1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024665 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024665|OTTDARG00000019911|ZDB-GENE-011128-11 gnat1|OTTDARP00000020343 gnat1-001 LG_ BX950172.16 Danio rerio protein_coding KNOWN, 1967 bp
CGGCCCAGGTGGTCAGATCCATCCCCAAAATCCCTCTAAG
ACTCCAAACAATTGATCAGTACTGGAGATCCAGTTGAGGT
GTGAGCTGTGAGAGCACCTGGAGGCCTCTAGGCAAGCGAG
TGGTCATCCAAAAGGACTTCTTTTTCCCTAATCAAAAGTC
AGTATGGGGGCCGGGGCGAGCGCCGAGGAAAAACACTCCA
GGGAGCTTGAGAAAAAGCTGAAAGAGGACGCAGACAAAGA
TGCCAGGACCGTCAAACTTCTGCTGCTAGGTGCTGGTGAG
TCGGGGAAAAGCACAATTGTCAAACAGATGAAAATTATTC
ACAAAGATGGTTACTCCCTTGAAGAGTGCTTGGAGTTCAT
TGTCATCATCTACAGCAACACCATGCAGTCCATTCTGGCC
GTTGTGAGGGCCATGACCACACTCAACATTGGCTATGGAG
ACGCTGCCGCACAGGATGATGCAAGGAAGCTGATGCATTT
AGCAGATACTATTGAAGAGGGCACCATGCCAAAAGAGCTG
TCGGACATTATCCTGAGGTTGTGGAAGGATTCAGGCATCC
AGGCGTGCTTCGACAGAGCCTCAGAATACCAGCTCAACGA
CTCTGCTGGATATTATCTAAATGACCTGGAGAGGTTGATC
CAGCCCGGCTATGTCCCTACTGAACAGGACGTCCTGCGTT
CAAGAGTGAAGACCACAGGTATCATCGAGACCCAGTTCTC
TTTCAAAGACCTCAACTTCAGGATGTTTGATGTGGGTGGT
CAGCGCTCAGAGAGGAAGAAGTGGATTCACTGCTTTGAAG
GTGTGACCTGTATCATCTTCATCGCTGCTCTGAGTGCATA
CGACATGGTGCTGGTGGAGGATGATGAAGTGAACCGAATG
CATGAGAGTCTTCACCTGTTCAACAGTATCTGCAACCACC
GTTACTTCGCCACCACATCTATTGTGCTTTTCCTGAACAA
GAAGGATGTGTTCGTGGAGAAGATCAAGAAAGCACATCTG
AGCATGTGCTTCCCTGAATATGACGGTCCCAACACCTTCG
AAGATGCTGGCAACTACATCAAGGTGCAGTTCTTAGATCT
GAACCTGCGACGAGATATCAAAGAAATCTACTCCCACATG
ACCTGCGCCACAGACACAGAGAACGTCAAGTTTGTGTTCG
ATGCCGTAACAGACATCATCATCAAGGAGAATCTCAAAGA
CTGCGGTCTCTTCTAAACAACACACTTTTTACAAGAGATT
GGCTGAATCAACAAAACCCAATGCTTTGCTCCTTGTAGCT
CGTTTCCTCCCTGGGTAACATACAGTTTCATGAGGGAATT
GATTACACGTGGAAGAAGAAATTCTATTACTGCTGTTGGG
ATCTACATTTGACTGCATGTAATTTAACACCAGAGCCATC
ACAAATTATACACAAGAACACATGCAGCATCACCCTGTTT
GAAAGAACTGGCTCTGAAGCGAGAAGTTTATAAGCTGTGT
TTTGGATCTGTTAGTATTTCGCAGTGATCTGTCCTGTAGA
TTTGCAACTACACTACATGCAGCTGCAAACCAAATGACTA
ACCAAATGAATCACCTGCATATGCACTTCAGCAGAAGTAC
TTTAAGAAGATTATATCAGTTATACATTATAGCAGTGACT
AACTGTGCAAAGTTCATGTTTTCAAGCCGATTAAGAAAAG
ACTTTACTGGCATACACTTCTGTTATTTTACAGAGGAGTT
ATGTCATGTAATGTCCTGTGATTGTCTATGTGAGGTGGAT
GACTGATGAGAAGATAGCATGTAATAATATTTGCTTAGAT
CAGGAGCACAGTTAGCAAGCTGAGAGACAATGAACACAAT
GTTTGAGTGCATTGATTAAACTACAACATCAAACACTGAT
TAAAAATGCCTAATTGACTGCAAAACCATGAACAATCATG
TACATGTAAATTAAAACAATAAAGCTTATGTAGAAAAGAC
TGAACCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations