Transcript

mchr1b-201

ID
ZDB-TSCRIPT-090929-7398
Name
mchr1b-201
Previous Names
  • mchr1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024568 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024568|OTTDARG00000019851|ZDB-GENE-030502-5 mchr1b|OTTDARP00000020270 mchr1b-001 LG_ BX465842.5 Danio rerio protein_coding KNOWN, 1056 bp
GTCCTCATGCCAAGCATTTATGGAGTCATCTGCTTCGTGG
GCATTATAGGCAACTGCATCGTCATCTACACTATCGTCAA
AAAGACAAAGTTCAGAGCCCAACAAACTGTGCCCGACATC
TTCATCTTCAGCCTGTCCATTGCTGATCTTCTGTTCCTCC
TGGGCATGCCGTTCCTCATTCACCAGCTAGTAGGCAACGG
CTCCTGGTGTTTTGGTGCCACCATGTGCACTGTTATCACA
GCGCTGGACTCTAACAGCCAGATCGTGAGCACTTATATAT
TAACAGTCATGACTTTGGACCGATACTTGGCGACAGTCCA
TCCCATCCGCTTTAATCACATTCGCACTCCCCGTGTAGCC
GTGGCAGTAGTAGCGCTGGTGTGGATCCTCTCACTGCTCT
CCATCACCCCAGTGTGGATGTATGCGGGTCTCATGCCCTT
ACGGGATGGATCAATGGGATGCGCTCTGCTTCTTCCCAAT
CCAGCCACAGACACCTACTGGTTTACGCTCTACCAGTTTG
TGTTGGCGTTCGCTTTGCCGTTGGTGATCATTTGCGTGGT
GTTTTTCAAGATCCTCCAAAACATGGCGGCCACGGTTGCA
CCACTTCCCCAACACAGCCTACGTGTGCGCACTAGAAAGG
TCACTCGGATGGCCGTTGCCATTTGCCTGGCGTTCTTCAT
TTGTTGGGCGCCTCATTACATCCTGCAGTTGGCACATCTG
AGTGTGCAACGGCCCAGCTATGCATTTCTATTTGCCTATA
ATGTCGCCATTAGCATGGGCTACGCCAACAGTTGCATTAA
TCCTCTTCTTTACATCATGCTCAGCGAGACTTTCAAAAGG
CAGTTTATTGTTGCCATCCGGCCGGCCCACAAGGACTTCC
GGGCTGATCCGGCCGATGGGAGTGTCAGTCTGCGTTTGGC
CCCTGACGTGGCCCAGCAGTCCCAATCATCTCGAGAGCTG
CTGCCGGTTACTGTGGCTGTGCACTGACAATATTATTCCA
CCTGGGAATCTGCACTGAGTCACACGAACACATTCTTTGT
GTCCGTAATGAGCACG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations