Transcript

sumo1-201

ID
ZDB-TSCRIPT-090929-7282
Name
sumo1-201
Previous Names
  • sumo1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024414 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024414|OTTDARG00000019764|ZDB-GENE-040426-2186 sumo1|OTTDARP00000020159 sumo1-001 LG_ BX927225.7 Danio rerio protein_coding KNOWN, 1436 bp
CAATGACGTCAACGGCGCTGTGTTGTGGGTCTGCTGGTAG
CACTAGCAAAACCTCTCATTACTGTACATAACACTGTATC
GTTTAAATCAAACAATCTTGATCTACAGAAGGGCTGCACA
TTGCGGAATATCATGTCAGACACGGAGACCAAGCCCTCAA
GTGATGGAGGCGAGAAGAAGGATGGAGAGTACATTAAACT
CAAAGTGATCGGTCAGGACAACAGTGAAATTCACTTTAAA
GTGAAGATGACGACACATTTAAAGAAGCTGAAGGAATCCT
ACAGTCAGAGACAGGGTGTACCCGTGAACTCTCTAAGGTT
TCTCTTTGAGGGACAGAGAATCACAGACAACCTGACCCCC
AAAGAGCTGGGAATGGAAGATGAGGACGTGATCGAGGTGT
ATCAGGAACAGACTGGAGGCTGTCGGAACGACTAGACCTT
TATTTTCATGCTCTTTATTTTTATCTTCATTTTGTATGTA
TGACGTGTTTCCTTTTGCTGTCACCTCAAAGGGAAGCAGA
AAAACCATCTGGATCAAATGCATAATCTGTTCTGACAGCT
GTGTTTGAGTTGGGGAGGAATTACAATAGAAAATGTCCTT
CTAGTATCTTCTGACTGTCTTTTTTTGTGCAAACCTATCC
ATACCTGCCTTCACGAGAGCCTCGCTTTTAAAGTATTCTG
GTCACATTTTGCATTGACATCTAATGTTTTGTTTCTTAAG
CTGACTGGAAACAGTACAGCACTGCTAAAAATCATTATAT
TATAGATTATATTAGTAAATCCAATCGAATTTATGATGGC
AGCTGTGGTGTTCATGTATATTCTCTATATAAATACAAAA
TTAAAGGGTTAGTTCACCAAAAAATTAAAACTGCTCAATA
TTTAATCTTCCTTCAGTAGTTTCAAACCTGAGATACTTTT
TTCTCTTGAACACAAAAGAAGATGATCTGAAAAAAGCTGA
ACAATAAATACTATTGAAATCAATAGTTACAGGTTTCCAG
CATTCTTTAAAGTATCTACTTTTGTGTTCAATAGAATAAG
GAAACTCATAAAGGTCTAAAACCGAGTGAGCGTGAGTAAA
TGATGACGGGATTTTCCGATTTGAGTGAACTGCCCCTATT
AGGCATTGTTCGCTAATGTTCTTGTAGTAAGTTGCTCTGT
CAGGATTATTAGCTTTCATTTAATATCGTTGTTTTTTTGT
ACATCATATACTAGTGAACATACCTCTGCCATCGAATTTT
ACAATCGAAGACGTACAGCGGTGGTTTATTTATGTGCAAT
TGTTGTCTCATGTTAGAAGTGTCACCAGTTTTATTGATTT
TCCTTCAGGGGTCTGCAACAACTGTGTACGGTTTGGTCCA
GATGGTTTTGTGGATCTAGGAGATTTATGACTTTGCTTTG
TCTTGTTTTTTTTTAAATAAAATGTGTCATAAAATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations