Transcript

fgf24-201

ID
ZDB-TSCRIPT-090929-72
Name
fgf24-201
Previous Names
  • fgf24-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000002076 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000002076|OTTDARG00000001944|ZDB-GENE-030708-1 fgf24|OTTDARP00000001832 fgf24-001 LG_ AL831789.6 Danio rerio protein_coding KNOWN, 2376 bp
GTGCGCTCCAGCCCTCCGCAGCACACAGACATACACAGTC
CTGTACCATCATCCAGCGCTCATCCAGGATTTGCCACGCG
ACTTTCCCTGTACAAACCACCCGGATAACAGTAAAGAAAA
TGTAAAGAAGAGACTTCTCGAAAAAAAAGATCATCTATCC
TGACAACTTTAGGACTAGTTGGGAAAGTTTTCCTCTTGAA
CAGCGGGCACACGGGACGCTTGGAATGAGGCGCGCGCTTT
CAGGTGTCTTCAGCAGGTACGAGCAGGATTTATATCGTTT
TTATATCGCGTGCTGGATCGAGAAGAAGCAGTGAAGTTCA
CGGATTGTTCGCCGAGAAGGAGACACCCCGATTGAACCTT
TAACCGATTCAATCTTTGCGCGCTTTGGCGAGAGAGCGCA
GCGCGCGCGGACACCACCGGGGAGACGTCGTTTTGCGTTT
GTTCCGATCTCTTTTCAAACGCGAAACAGCCTCATGCTGC
TTCCAGCGGCACATTTACGCTTCCCTCATCTCTGTTTTCC
CTGGGATTGCACCTCTCCTCCGGGGTTTTGTTTGTGAGAC
ACTGGCGGGGCTCCGCGCGCCACTTACTGGAGCGGCAAAC
GCTGGAAACAGGTGTATTTGACCAAGATGTCTGTTCTGCC
GTCAAGGTTCATCTACGTGTGTTTACATTTGCTGGTGCTC
TACTTCCAGTTGCAGGAATCTCACCAGAGTTCTGCTGACT
TCCGGTTCTACATCGAGAACCACACTCGAGACGACGTGAG
CCGAAAGCAGGTGCGGATTTATCAGCTCTACAGCCGAACC
ACCGGCAAACACGTGCAAATTCTCGGCAAGAAGATTAACG
CCAATGGAGACGATGGGGGCAAGTACGCTCTGCTTGTGGT
GGAGACAGAGACTTTCGGGAGTCACGTTCGAATTAAAGGG
CAGGAGAGCGGATACTACATCTGTATGAACAAGAACGGCA
AAATTATTGGAAAGCCCAATGGGAATAGCCAGGAGTGCGT
CTTCGTGGAGGAATATTTAGAGAACAACTACACGGCGCTG
ATGTCGGCCAAATACAGAGGCTGGTATTTGGGCTTCAATC
GAAAGGGTCGACCTAAAAAAGGCTCCAAGACCACGCAGAC
GCAGCAGGAAGTGCATTTCATGAAGCGCCAACCCAAAGGA
AAAGAGGACCTGCCGGAAAAGTTCCTTTTCACAACGGTAA
CGAAAAGGACACGAAGGGCACGGCGTTTAAAACCCAACCC
CAATACAAACTGACTCAAGTTCACAAAGGACTCGACGTAC
TTCTTGCCACAATCACCTTAATCTTATCCGAAACTGGAGA
AGGAAGAGGACATAAATAAACAATGGCTACCGAAAAGAGA
CAAAAATAAAAAAAAAACTCAAAGATGTTTTATTTTTATA
TTTCAGAAGCATCAAGTTTCTCCCAGCTGTTGAATGTGGG
TCTTTTTTATGTAATATTGGTGTCTGTTATTTTATTTATA
CTGGATTAACTAAGGATGACCTGTAAGGAACTAGTGTCTC
CTGCTTCCTGTTAAAACTGTGGAATACCGACTAGAGCAAA
CCGCACCGTCTGGGAAACCTTGCATCTTCATTTCTGACAA
CAAGGATCCAATATTTTCCACTGGAATCGGCTGAGAGAGA
GAGATTATAAAGGCATATGACCTTTGCAAGCCTCCATAGG
TAAACGTGAAGCTTTGAGTGCAATATTTTGAAGAACCGTG
TCGTTCCTCTCTGTCGAACGCATCTGAGCGGACACCAAAC
GCGCAGAACGCTTTGAGATTTATGCGTATTCTGAGATTCA
GCTTCGACTAGCCAGATGTCAGCTTTAGATGTGGTAATAA
TGTGTGTGAGAACTAACAGTCTAGATATGAAGGGAGTGGA
ATGAGTTTTTCGGGATCACTCTAAGCCATCACCGTGTGTG
TTTTCTAAAAGTTAGCAACCAAAACATGCTTAAAACATGT
TATGCATTAACCAGGTTTGATGCATTGCTCTTAACGCCCC
TGATGCTCTTTTAAGTGTCAGATTTGACTACTTCCTGGTC
ATTCAGCCAATGAAATGGGTTCACCTGACAATCGAGTTCT
AGAACACGTTCTAGAGCATCTGGAACACATGTGAACAGAG
GACTCCAGCCACTGTTGGTGAGGTCGACTCTCCATATGGG
TATAGCTGTAGTATACACACGTCTATATACTCATTGTCTG
TCAGACGTTACTAACAATCATGACACACGTACGATTAAAA
AACAAATGTATGCAAAAAATAATAATTTTATTACTATTAT
AAAATATTTATTGCCTTTCTCTGTAAATACGACTTGATGA
ATTTATTTGACCTCTGTTAATAATAATTAAAAAGAGGACT
ATATATGGAAAATGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations