Transcript

pnocb-201

ID
ZDB-TSCRIPT-090929-719
Name
pnocb-201
Previous Names
  • pnoc-001
  • pnocb-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000006416 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000006416|OTTDARG00000005854|ZDB-GENE-040114-1 pnocb|OTTDARP00000005709 pnocb-001 LG_ BX279523.5 Danio rerio protein_coding KNOWN, 1260 bp
GTAATACCCTGCCTTGGTGTAGCCCCATCCACAGACACTG
GGGAGGCTGAACCACTGGAAGGGGTGTGTCGTTATAAGAG
GGGAGAGAAAGGGAGCAGGCAAGCAGTTGAACAAACCCAG
AAGCTGAAGATTGGACATATCCACCACACCTCAAGACTGA
AAGTGACAGAGAGACCCCTTATCACCGACGGCAGAGAGCC
CAGTGTCTGATCTGAAGTTCCTGCCTCATTCCTTTGTTCT
GTGAGGAAGTCATGAAGACTCCATTTTGGACCCTGCTGCT
CTTATGCTTGTGCGCTTCAAGTCACAGCGACTGCCAAGGG
GACTGCTTAACCTGTGGACTCATCCTGCCTGAACACCAAG
CTTTTAATACACTGGTGTGTATCCTGGAATGTGAAGCACA
GGCGTCTCCGGCACTGACCTGGGATCTGTGTTACCAAGCA
GCGGGTTTGAAGCATCTCCCACTGCCCTTGCAGGACGAGG
AAACATCAAAGCGCTCAGATGATGAAGCGGAGCCTGTGGC
TACAGTCAGCATAGAGAATGACAACGGTGTCGAATACACG
GAGGCTTTAGAGCGCTTTCGACACGCTCTGCAGCCTTCAG
AAGAGCTGGAGAAACTCACGGCTTCATATGACCCAGACCT
CGACCCGCGGACACAGGAAGACCAGGATGATTTAGGAGAC
GAGAAGAGCGACGACGCAGCCGTAAGCGTGTCCAAACGAT
TCGGGGGCTTCATGAAAGGTCGTCACGGTTTACGTAAGCT
GGTGAGCTCCGGAAGGCCTTTGCAGAAGCGCTACGGAGGC
TTCATAGGGATCAGAAAGTCTGCCCGTAAGTGGAACAACC
AGAAGCGCGTGAGTCAGCTCCTGCGCCAGTACCTGAGTTT
AACGGGCCGGTCAGGTCGCTCGGGTCACATCAACAGCCTC
TCCACCAGAATCCGGAGACAGAGCGAGGTGTAGGTGGCTG
TTAACACAGGCCACGGTCACTTACCTCATCAGTAACTGTG
AACATCTCCATCATGACATGCACCGCGACCCCAGAACTAA
TGTTAGATGTAAATCTGTGTTTAATCAAAGAAGAGGAATA
TTTTGTATAGCTGGGTTTTTAATCATTGACATTTCCATGG
TGGCGACATCCCCCCCAAAAAAGCATCTGTTAGGACGAAT
GTTGCTGATGATGAGAACTGATTGTTCATTTATCTGAAAC
TCCGTCAATTAACCTTTGAAGCATTGTGAATACAAAATAA
TAAAAGGCAAATCAGTGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations