Transcript

xpr1b-002

ID
ZDB-TSCRIPT-090929-6737
Name
xpr1b-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023771 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023771|OTTDARG00000010112|ZDB-GENE-060503-266 xpr1b|no_translation DKEY-60B12.7-002 LG_ AL953893.17 Danio rerio protein_coding KNOWN, 768 bp
AGATTGCTGGTTTTCTTGGAGTTCTTTGGTGTGTCAGTAT
TCTGTCCTGCCTCTTCGCAGAAAACACATTGATCCCTATA
CATATGAACCCTCTAGCTCTATATGGGTTCTTCTTCCTCT
TCCTCATCAATCCCTTAAAAACATGCTACTACAAGTCTCG
CTTCTGGCTACTCAAGTTACTGTTTCGAGTGGTCACCGCT
CCATTTCACAGAGTGGGCTTTGCAGATTTCTGGCTGGCTG
ACCAGCTCAACTCTTTAGTGGTTGTTCTGATGGACCTGGA
GTACATGATCTGCTTCTACAGTTTGGAGCTGAACTGGACC
ATGTCCGAGGGAGAGCTGTGGATTAAAGAGGGTGAACGAA
TTTGTTACTCGTATTCATATGGAGTACGAGCTGTAATCAA
GTGTTTGCCTGCCTGGTTCCGGTTTGTGCAATGCCTGAGA
CGTTACCGGGACACTAAGCGTGCCTTCCCTCACCTGGTCA
ACGCTGGCAAATACTCCACTACTTTCTTCGTAGTCATCTT
TGAGGCGCTCTTTAAAACGCATTCAGGTAAGCACACGAGC
TGTTACATTCTTACTCTAAACATCAAATGCTTCAGATGCC
ATGTGCAATTCTGTGTTTACCCAACACAACTTTGTTGTTT
CCACTCAAAACATGTGAAATATGCGGTATGTTGTGTAGAA
TGCAGCTGATGATACTGTTAATAGAGCTACAGCGGACTTC
ATTCAGCTAAACACACTGTCCTGTGCTCATGATCTCTTCT
CTGTTACC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations