Transcript

sox11b-201

ID
ZDB-TSCRIPT-090929-669
Name
sox11b-201
Previous Names
  • sox11b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000006212 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000006212|OTTDARG00000005704|ZDB-GENE-980526-466 sox11b|OTTDARP00000005527 sox11b-001 LG_ BX248324.9 Danio rerio protein_coding KNOWN, 2699 bp
TTTGACTTGGAGTGCGGCAGCTGCTAGAGTCTATCAAGAG
GGAAAAGTGTGTTTGAACATGGTGCAGCAGACGGACCACA
GCGAGACGGAGAGCAGCGTTTCGCGAGAGACCACAGACAC
CGAGGAGAGCGAAATGATGGCTTGCAGCCCGGTGCCACCG
AAACCGGACTGGTGCAAGACAGCCACCGGCCACATCAAAC
GACCCATGAATGCGTTTATGGTATGGTCCAAAATCGAGAG
GAGAAAAATCATGGAGCAGTCTCCAGACATGCACAACGCA
GAGATCTCCAAAAGGCTGGGGAAGCGGTGGAAAATGCTGA
AGGACAGCGAAAAGATTCCCTTTATCCGCGAAGCCGAGCG
GCTCCGGCTCCAACACATGGCTGACTACCCCGACTACAAA
TACAGACCCAAGAAAAAACCAAAGCTCGACAGCTCCTCAA
AACCAGCAGTGCAGTCGCCGGAGAAGATTAGCAAAAGTGT
CAAAGCAGCCGCAGGGAAGAAGTGCGCCAAACTCAAGCCC
AGCAAACCGGGGAACATTACCGCCAGAGCATCCACACAAG
ACTGCAGATTCAACTATGTTTTCACAAACTTAAAAGTGAC
CAAGTCTATCAAAAGGGAACTTACTGACGACGAAGACGAC
GACGACGATGATGATGATGACGACGACGAGGAGGATGACT
ACGAGGACGAGGAGCACATTAGGCTGCACAACGTCCCCGC
GAGCCCCACGCTGAGCTCCGCTGCGGAGTCCGAGCATGGC
GCGAGCATGTACGAGGAGTCCCGGCACACGAGCGCGACTC
ACGGCAGCAGACTGTTTTACAACTTCAAGAACATTACCAA
GCAGAGCGCAGCTTACCCTGCCTCGGTGTCACCAGCATCT
TCTTTCAGGTCAGTCTCCTCTTCGTCCAGCAGCTCCAGCG
AGGACTCCGACGACTTGCTGGTGGACTTCAGTTTGAACTT
AGCGGCGGGCTCTCACACCGCGGACTTGGGGAACACTTCA
GGAAACCTTTGCCTCTCTCTGGTGGATAAAGATTTGGACT
CGTTCAGCGAGGGCAGCCTCGGTTCTCACTTCGAGTTCCC
GGACTATTGCACTCCCGAGCTCAGTGAGATGATCGCGGGA
GACTGGCTGGAGGCGAACTTTTCAGACCTGGTTTTCACTT
ACTAACTGACAAACTCCTCCATGACCAAGGAGGCATTGCG
CATCTTCAGGTTATTTTTTGACTCTGCCTCGGTGGTTGTC
CCGGTTTAGACGGAGGAACGTGCGTTACGAGACGCGTAAC
GTTAAGAAAAAAAGTGACAACATGGTCCAAACATTGACTG
TGCTGTGTGTGTATGGCAAGCTCTTTTAACATTTACTCCT
TGAAACTGCACGGTATGGTCTTATTTGACCATCACTCAAA
TGCCAGTGAATGACACACAAGGATTTATTTTATTTCTAGT
ACTTTAGCGAAAACACTTTATTCCTTTGCTGCTAGTCACT
ATCACTTATGGCAAGTAACTCTTGTGCTATTAATTTTAAC
AAATTGTAACATGTTTTCTCAGCTGATTGAAATGTTATTG
CTGGCACATTCTCCAATTTTGCCTGTACCTAATACTACTA
ATAATATTAAGCCATTCCATTTGGTACTAATCTAGTATAG
TGACCTGAAGAATTAAATTATAGGGTATTATATAAATAAA
TTGCTAGTGAATTTGAGACACTAACCACTATTGAATCACT
AATAAGTACAAGTCACTTGAAAAAAATTAATGCTAGTTAG
TTAGAAAGCAGTAAATGTTAAAGTAGCTTGCCATAATGTG
TGGTTATTCTGTGGGGTTGCAGTGAAACTGCTTAAACTGT
GGTGGAGCGCAAAATGTAAAATCTGAACTATGCATTCCCA
TCCCACCCGTATCTCTACAGGGAGCTGGCAAATGGCTGCT
TGACTGAATGGAGGCAATTCTGAAACACTGTTCAGGATGG
AACTTTTTCTGAGGTCTTATGTAATTTCTGTACGTCACAA
ATGTTTCTTTTTTTTTCTATCCGGTTCAGTTTCCCTCCAA
GTATGGGGATATTTTACGCAGATAACCACTCTAGAACACA
CAGGTATGGCAGGAAGCATTTTGATACATGACCAACATAC
CTCATCTTTTTAAAAAAAAAAAAGTAAAATATTTTCTGGC
ATATTTTTGTACAGTTAAAGGGAATGTTCTTACTGTGCTT
TAAGTGAGGTTTCTTCAGGCACTTCAACCCGGTTTCATTT
GTAAAAGCATGCAAGAATTAAACTGACAAGTCGACTTGCA
TTTAAATGCCTGGTTATTATTTTACTCAAGGCAAGTGTAC
AGCTGTAGATCTGAAGCGTTTCTATAGGGAAAATGTACAA
TGGAATTGGGGGAACACATGAGCCTCATTTCTGGTACTAG
ATTGAAGATTGTATATGTTCTGTAATATAGTAAAGCTAGG
AGTTTATGTATATCTGTGTGAATGGGTCCCAAATAGCAGG
TGTAAAACTGGATTTTGTATTGCTTTATTTTATTTTTTTG
TTTAGTTTTTGTTTGTTGTTTTTTTCCATCATAATGGCAC
ATTGTTTTTTTTATTTTATTTTGTGCAATATACTCCCAAA
ATGGACCATCTGCGTTTTGTAGCAAAGGAAATGAGTTACA
TGTCGTCATGCTGAAGTCTGTATCTGACACAAATAAATCA
GCTGGAACTGATAAGAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations