Transcript

aldh2.1-201

ID
ZDB-TSCRIPT-090929-6335
Name
aldh2.1-201
Previous Names
  • aldh2.1-001
  • aldh2a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023139 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023139|OTTDARG00000018931|ZDB-GENE-040426-1262 aldh2.1|OTTDARP00000019262 aldh2a-001 LG_ BX510999.12 Danio rerio protein_coding KNOWN, 1935 bp
GGTTATTGTTGTTAGTTCCAGTGCTGAAGGCGAGGGAGCA
GAAAATGCTGCGCACCGTTTTTTCCCGAACTTTTCCTCAA
GTTTTTCGCATCTCCTCATGTCAACATTCAACGATTCCTG
CACCGAACGTTCAGCCTGACGTGCATTATAACAAGATTTT
CATTAATAATGAGTGGCATGATGCTGTAAGCAAGAAGACT
TTTCCAACCATCAATCCTGCTACTGCTGAAGTGATCTGCC
ATGTCGCGGAGGGGGATAAGGCTGATGTGGATAAAGCGGT
GAAAGCTGCCAGAGATGCCTTTAAGCTGGGCTCTCCCTGG
CGCCGCATGGATGCGTCTCAGCGTGGGCTGCTGCTGAGCA
GATTAGCAGACTGCATTGAGAGAGATGCTGCATATTTAGC
TGAGCTAGAAACTCTTGATAATGGAAAGCCATATACACTC
TCCTTCTGTGTGGACTTGCCCATGGTGGTCAAATGCTTGA
GGTATTATGCTGGCTGGGCAGACAAATGGGAGGGTAAAAC
CATCCCGATTGATGGCAATTACTTCTGCTACACAAGACAT
GAGCCCATTGGAGTCTGTGGGCAAATTATTCCTTGGAATT
TCCCTCTATTGATGCAGGCGTTAAAGCTGGGTCCGGCTCT
GGCCACTGGAAACACAGTGGTGATGAAGGTGGCGGAGCAG
ACGCCGCTCACCGCACTGTATATCGCCAGTTTAATCAAAG
AGGTTGGTTTTCCTGCTGGTGTTGTCAACATTATCCCAGG
GTTTGGTCCCACAGCAGGAGCAGCCATTGCTTCTCACATG
GATGTGGACAAAGTAGCTTTCACCGGCTCCACTGATGTCG
GTCACCTGATCCAGCAAGCCTCGAGTGCCAGTAATCTGAA
AAATGTCTCACTGGAGCTCGGAGGAAAGAGTCCAAACATC
ATCCTGTCAGATGCTAACATGGAAGAAGCAGTGGAGCAGG
CCCATTCTGCCCTGTTCTTCAACCAAGGCCAGTGCTGTTG
CGCAGGCACTCGCACTTTTGTACAGGAGAGCATCTACGAT
GAGTTTGTGGAGCGAAGTGTGGAGAGAGCCAAGAATAGGA
TTGTGGGAGATCCCTTTGACTTAAACACGGAGCAGGGCCC
GCAGGTGGATGAGGATCAGTTCAAGAAGGTTCTGGGCTAC
ATCAGCAGCGGGAAGCGTGAAGGAGCCAAGCTGATGTGTG
GAGGAGCTCCAGCCGCCGAGCGTGGATACTTCATCCAGCC
CACAGTCTTTGGAGACGTCAAGGACGACATGACAATCGCT
CGCGAGGAGATCTTCGGGCCTGTTATGCAAATTCTGAAGT
TCAAATCTTTGGAGGAAGTGATTGAGAGAGCCAACGACAG
CAAATATGGCCTCGCGGGTGCTGTTTTCACCCAAGACATC
GACAAGGCCAATTACATTTCCCATGGCCTGCGTGCTGGGA
CTGTGTGGATTAACTGCTATAACGTGTTCGGAGTTCAGGC
TCCGTTTGGAGGCTACAAAGCGTCAGGAATTGGTCGTGAG
TTGGGCGAGTATGGACTGGACATCTACACGGAGGTCAAAA
CGGTTACAATTAAGGTTCCTCAGAAAAATTCATAAATAAA
GCAATTAAAGAAGATGCTGTTTAGTCACGAATTGCCACGT
TAAGAATTGAAAATATTGTGGTAATGTGTAGTAAAAAATA
GGTTTTGTACTGTAGGTAAACTCCTTAAAAGTAAAGGTCT
GTCAGAGCTTACTTATAAAATTGATTTGATTCTGTTTAAT
TCAGACTTCATGTGAACAGCATAATTGTTTGAACGTATGA
GCTGATTTATGTATTACATGTGGTTTTGTTTCATTTTTAT
TTCATTTATTTTTAATGCATGTCAATGCATGACCTTTTCT
GATGATCATTTGTAATAATATGCATTAGAAAATAAAATAA
AATCCAATATTAACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations