Transcript

mepce-201

ID
ZDB-TSCRIPT-090929-6294
Name
mepce-201
Previous Names
  • mepce-001
  • si:ch211-283h6.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023083 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023083|OTTDARG00000018901|ZDB-GENE-030131-3936 mepce|OTTDARP00000019231 CH211-283H6.1-001 LG_ BX537304.14 Danio rerio protein_coding NOVEL, 3977 bp
GCGAGATTCTGCAGCTCATTAGTAAGTTCAACCGAGTAAG
CGCAGTAGTTTAACCGAGCAGTTAGGGCTTATAAAACACA
CAGAAATCGATCACTGTGATCAATATCTCCACAAAGCCTC
GCTGATATCCTGAAATAGTGCTCGTCCGTAAACCACGAGC
GTTATTTTTTGAGGGGCGTGTCCTGTGAATGTGTTATTTT
GATTGTGAAGCTGACGTCAGCGGACAGCGGCGGGATGTGT
GCGGACAGAAGCCGTTACTCTGACCGAGCCGCTGTGCGCT
TTTTTTCCCCGTCCGCCGGAGAGGGAGGCAAGCGAGGGGC
CGTGTGCCTTTAAGAGAGGGCGGAGAGAGTTGGAGCCCCG
GGCTGTGTTTTGATCCTGTTTAGGTATCCCTTCGCTTTCT
CTCTTCTGTTTTCTTTCGAGCTGATTTTACTGTGCGTTAT
GTTTTATTCATGATGACGCTTGGGGGCGGGGCTTGGACGA
ATTGTCAATAATAACAGCGGCGTCGAGGAGGCGGGCGCAG
TGAAGATCCATGTCTCCATCAGTGCCAGCCTGAAATAAAA
AATGATAGAGATGTCATTTGACAAAGAAACTGTTTTATCT
TGTGAGGGGCAAACAGACCCCACTTCTCAAGAATTTAATA
TAAATGATACCAGTGCTCTCCATCCACCCGGGAACACCAC
AGAGAACAACCTCAGTAAGGACGCAGGAAGTGAGGCATCC
CTAGAGAAATCTGCTACCACCGATAACAATGCTTCAAGTG
AAAGTGCAGTTCTTGGGGCTGAATCGTCTAAACAATCGCA
CAATGGCACCAAACCACAACAGCAGAAAGTCAACAAGCGC
CGCAACACTATGAGCGCTGGGTTTAAGCACCCGGGTTATG
GCAAACGACGACGGCGAGCCAACTCGGAAAGCGAGTCAGT
CCTGCCAACCAATTTCCTGCTGGGCGGGAACATTTTTGAC
CCACTCAACCTTAACAGCCTTTTAGACGAAGAGGTCAACA
AGGCTCTCAATGCAGAGACGCCCAAGTCTTCGCCATTGCC
AGCCAAAAACCGAGACCCTGTTGAGATCTTGATACCCAGA
GATATCACAGACCCCCTCAACCTCAACTGCCTGAGCACAG
GAGACAGTCTGCTGGTGTCTCCATTGAAGAGTGGTGGAGG
AAGGCGGAGACATCGAAACAAACACCATGGAGCAAACACT
GGACGAGTTTCCACTGAAGGAATTGGTTTAACGGAGTCTA
ATGGCTGTGCAGCAGTGAAGGATGATGGAACATCATTGGT
CTCGATGACTAATGTGCATTTAGAAAGTACAATTGCGGAT
CAAACTCTGTTGGACTCGACTCTCGAGTCTTCAAATAAGT
CCAGTCTAACTTCAAATGACAATGAGGTGAAGGAGAAAAC
CGTTGACTGCTCAACCGCACATCTAACAGCAAACCCAACC
AACCCTCCATCAAGCAGGCAGCGCAAACGCAGGCGAGCCG
GCAGCAGAACGGAGAACTCCAGTTCTTCTTCTGAGGTGAA
AAGATCGGGGAGACATTTTCAACACAATGAATCCCAAGGA
GGAAACTCTCGAAGTGGAGTCTCTGATAGGCAGCAACCGT
ATCCGAATCAATGGAGGCCGCAGTACAGCAACAACAATCA
GAACCCGCAGCAGCCCAAAAAGAAGTTTCAATACGGTAAC
TATAACAAATACTACGGCTATCGGAACCCAGGGATGAGCG
AGGATCCTCGCATTCGTGTTATGAATCCGGATTGGTTCAG
AGGGAAGGATGTGTTGGATCTGGGATGCAACACTGGCCAC
CTGACTCTGTTTATCGCAAAAAATTGGCGGCCTGCTAGTA
TTGTGGGCCTGGATATTGACGGATCGCTGATACATGCTGC
TCGACAGAATATAAGACACTACCTCTCTGAGGTCCAAGTG
CAGCACTCCCGACGCTCTGGGGAAAATACAAAGGCAGATC
GAGGGGAGGTTTCGGGAGAAGAAAAGGACAAAGATAAAAC
TAGTTTGGTTATGGATGAAAAAAAGGCAAAGCATGTTGAC
GAAGTGAATAAATGCATGGACGAAGGAATGGAAGTTAATC
AAGAAGAGAAGAGGGAGGCTGATCGGGGAGAAATAGGGGA
TGGAGCATCGGTAGATCTCCCTGATGGGAAACATTCGTTC
CCCGTCTCGCTCCGGATCTCAAGAGGACCCATTGCTGGGC
CCCCTTTGCCCGAGACAAACACACACAGTCTCCCTCCTGG
AGATTTCCCTGCCAACGTGACCTTTATTAAGGGGAACTAT
GTGCTGGAGAGTGATGTGCTGCTGCAGACACAGAGGGAGG
AGTACGATGTCATCCTGTGTTTGAGTGTGACAAAGTGGGT
CCACTTGAACTGGGGCGATGCAGGACTCAAGCGCTTCTTT
CACAGGGTATACAAGCACCTGCGGCCAGGGGGACTCTTCA
TTCTGGAGCCCCAGCCCTGGAGCTCCTACAACAAGAGGAA
GAAGCTCACCGAGGCCATCTGTAAGAATTACCACAGCATC
CGGTTAAAACCAGACCAGTTCTCCTCTTTCCTGACGACTG
AGGTGGGCTTCTCCAGTTATGAGCTCATTGGGACGTCGCA
AAACTACTCCAAAGGTTTTCAGAGACCAATCTCTCTGTAT
CACAAACGACCTTCATCTTTAAAGTGACCGCACCAGTTAG
AGATGGATTTTTTTGGGGGCTTATTTTTTTTTTTTTTTTT
TTTTTTTTTTGGAGAACAACCAGCATTTGAAGCCACTAGA
ACTTAAAACATTTAAGACTTTAAAAATTCTTAAAAACTCT
CTTAAATGTCTCGTTGGTGCTGAATAAGATTGCTCCCCTG
CTGTTATAAAATAAAGGAAGACCACAGCATTTTCCAAGGA
CTCCAATGAAGAATTAGACCGATCAGATGCTCGTATTCAC
TGTTCAGATGTTTTTACCGCGCATAAAGAAAGGTCTTGTG
AAGAAGCACAAGTTAAATCCAATTCCAAAAAGTCATTTCT
AGAGTAATTTGAAAGTGTTTTTTTTTCTCGAGCAGCTTCA
CAGCATACATACTGTACCTGGTAAGTCATCATCTAGAACA
GTGTTTCTCAACCACGTTCCTGGAGGACCACCAGCTCTGC
ACATCATCCATGTCTCCTTAACCAAACACACCTGATTGAG
ATCATCAGCTCATTAGCAGAGACCTGTATTGGGTGTAGCA
GAGAAAGGAGACATCCTAAACATGCAGTGTTGGTGCGCCT
CCAGGAACGTGGTTGAGAAACGCTGGTCTAGTACTCAAAT
GTTTAGTGGTTAAGTTTTCTTTTGCCTGCTTGTTTCTTTT
TTCCCCTCATAAGGAAAGATTAGAGCATGTTACCAAATGT
TGAGTTTCAGATTTCTTCTGGCGATTCTGTTAATGTTGTT
GCTGCATTGCTAACATCACTTTCAGCATCTGTTATTCCTC
ATCAGCCGTTGTGCATCTAGACGGGGCCGCCAATTATTTT
AACAAATGCCAATATCTCAATTTTTATATTCACCATGAAA
TCGCCTGATCATAGATTCATCATTTGGGAGTTCTGAAGCT
GCGGGTTAGCTGATTTGCTATGTTGAAAGTGTTTACTAAA
ATAAGTCAGACTGACGCCAGAAGGAGGTGAATCTTATTTT
GGTGTGAGCTGAGCTGCAGAGAATGACGTTAACTTTTTGT
TATTATTGTTTGGTCTGTTGTTCTGCTTTTTCAACTTGAT
TAAGTTGAGCTAAAACCGAGGTACATTTTTGTAAGTTGTT
CGTCCAGAGTTCTTGTGTCCATCGAGGTAACTTTGTTGTT
GTTGTTGGTTTTATTCCTATTGAAAGGTTTGCACTAAAAA
CGAGAGAACAAACTGATCTCCAGCATTTGTATTTTAATGT
ACAAATGTAATGTTGGTGTGTCTTTTGAAATAAAAAGGGT
CCTTTTCATTCAAGAGACTCGAATAAATTTGAAAAATAAA
CTATAAAATAACATGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations