ZFIN ID: ZDB-TSCRIPT-090929-6206
Transcript Name: pax6b-202
Previous Name: pax6b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022984 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022984|OTTDARG00000018846|ZDB-GENE-001031-1 pax6b|OTTDARP00000019167 pax6b-001 LG_ BX000453.8 Danio rerio protein_coding KNOWN, 4993 bp
ACACCGTTTTTTTTTCATTCTCGCTGACATTTCCACACCG
TACGGGATTCAAACGTGACACAATCTGGACTCATGAGATC
GTTTTAATTAATTCCAGCGCAAGGGCTTGAAACAGCAGGA
TATTGATCAGAAGTCGGAAATATTCCGGGAATTTCCTTCC
AGATAAGAGGTACGCTGGGAAAACGTATATATTTTTTGGA
CGAAGAAACTACCATTGGACAGTCATTGTTTATTTCCAAG
TTTCACTGTTTTGCTCGGAAGGGCTCAGGCGGTGGAGCAG
AATGCCTCAAAAAGAATACCATAACCAACCCACGTGGGAA
TCAGGAGTGGCGTCCATGATGCAAAACAGTCACAGTGGCG
TCAACCAGCTTGGCGGGGTGTTTGTGAACGGCAGACCGTT
ACCGGACTCCACCAGACAGAAGATCGTCGAACTCGCACAC
AGCGGAGCGCGACCCTGCGACATCTCCAGGATTTTGCAGG
TGTCGAATGGGTGCGTGAGCAAGATTCTGGGGAGGTATTA
TGAGACGGGCTCCATCCGACCGCGAGCCATCGGAGGCAGC
AAGCCCAGAGTAGCGACGCCTGAAGTGGTGGGCAAAATCG
CACAGTACAAGAGGGAGTGTCCATCTATATTTGCCTGGGA
GATTCGGGACAGGCTGCTGTCGGAGGGTGTGTGCACCAAC
GATAACATACCGAGCGTGTCGTCGATAAACCGAGTGCTAC
GCAACCTGGCTAGCGAAAAGCAACAGATGGGTGCAGATGG
CATGTACGACAAGCTGAGAATGCTCAACGGGCAGAGCGGC
ACGTGGGGGACTCGTCCGGGATGGTACCCTGGTACGTCTG
TGCCAGGACAACCAAATCAAGACGGTTGCCAGCAACAGGA
CAACGGTGGTGAAAACACAAACTCCATCAGCTCAAACGGC
GAGGACTCAGACGAGACTCAAATGCGTCTGCAGCTGAAAA
GAAAACTGCAGAGAAACAGAACGTCCTTCACGCAGGAGCA
GATCGAGGCACTTGAGAAAGAGTTTGAAAGAACACACTAT
CCAGACGTTTTCGCAAGAGAGAGACTTGCGGCAAAAATTG
ACCTCCCGGAAGCAAGAATACAGGTCTGGTTTTCAAACAG
AAGAGCCAAGTGGAGGAGAGAGGAGAAACTGAGGAACCAG
AGACGACAAGCCAGCAACTCCTCCAGTCACATTCCCATCA
GCAGCAGCTTCAACACCAGCGTCTATCAGGCCATCCCACA
ACCCACCACACCTGTGTCCTTCACGACAGGCTCAATGCTG
GGCCGACCAGACACAGCTCTGACCAACACATACACGGGTT
TACCCCCAATGCCCAGCTTCACTATGGCCAACAACCTGCC
TATGCAACCAAGCCAGACATCTTCCTATTCCTGCATGCTG
CCCAGCAGTCCGTCAGTGAACGGGCGAAGCTTCGACACTT
ACACCCCCCCTCACATGCAGGCACACATGAACAGCCAAAC
TATGGCCACTTCTGGCACCGCTTCCACAGGACTCATCTCT
CCTGGAGTGTCTGTCCCTGTCCAAGTCCCCGGAACTGAGC
CTGACATGTCTCAATACTGGTCAAGATTACAGTAAAGAAA
AGAGCTACTTCGCCCTTTGACTTGAGCGCACAGAGACTGA
GCGAGAAGCTGGACGCGTCTGCACAGTATTTCCGCACACA
GACTCAAACAAACTGTCATGAGGATGAGGCGCGAGCTCTT
TTCACACTCCCAGAACTTCTAAAAAAAAAAAGAAAAAATG
GAGAGACTTTAATGGAACAAAAACAAGCGACCTCTGCGAC
ATCCACATTTTTCCAACTCATTTTTTTTTGTACTTGTACA
TCAGCATTTATATGTAAAGAGAGCAGCCCATAAAATACAC
TGGTGTCCTCTAATATTGGCACCCTTGGTAAATATGAGCA
GTCTATGATAAATAGTCTTTGTTGTTAAACCTTTTGTCCA
TTTTGTTCAAAATATGAACAAAAAATATCTCATTGTAAAC
CGTTTTATCACGTGCAAAATTATTGGCACCTCTCAACACT
TATTTTTTTTTATTTTTTTTTTATTTTTATTTTTTTTTAC
TTCTATGCCCAATGATACTTACATATCACTGGGCAACTGT
TTAATCAATAAACAAAAGCCACACTGAAAAAGACGTTCAT
TATAATGATTAAAACCAAAAAAACTGAGCTGTGATTTGTG
GCAAATATTCACGAAATGGAAAGTGTCTATAAAAAAAGTC
AAAAACACTAAAAAAAACAACAACAAACATTTTCACCGTC
AAAGAAATAAGTAATATGTTTCAGTTAACTGGAAATGATT
ATGAATTAGCTTGGAAGTGGATGTTTGCCCATTGTCTCAA
ATGCACTCGGTTCACCAAAAAATCGTCAAGAATCAGTTTC
TGGTCCTAAAGGCCTGTTCACACAATGGAAATTTTTACCG
CACTTAATCGCCAATGTTTAACACCTCATGACTAAATAAA
GGGCACCAATGTGATCATGCACACCAAAACAACAAACATC
AGGCATAAAAGCGTCTTTTTTTGAAAGCTCACACATATGG
CTAACATTCAACACCTTATGACTAAACAAACGGCATCAAT
GCGAGTGTGCACACCAATGCGTAAAACTCATAAAAGGCAT
AAAAACTTAAAAAATAATAATTTATTGGTTTGATGTGCCA
CGTTAAAACGGTTTACTATGCTGCTGAAATTACAGTAAAA
CACCACTTGGTGGTGCTCAAGCTCAAAACAGTCCAGGCGA
GCACACATTGTGTACCAGAGTATTTTTGTTTTTCGTTAAG
TGCCATCTACTGTCAGGGAGTGATTTTGCGCATGACTTGG
TTTATTGCCAGTGAAAATTGCTAGGGTTTAATCGCCAGAA
AACCTCTAAAACAATGTTTTTCGCTAACGGTTATCATGCT
TCGTGATTAAATAAATGCCTCATGACTAAACAAACTGCTC
TAATGTGAGCGTGCACACCAACGCATAAAGTTTAAGACAT
AAAAGCATAATTTAAAATAACAAATGTCTCTTTCTTATTT
GTATTTTAGTTTGACGCGCTATATTTAAAACTGGTTGACC
AATGAGATTTACTGAAGTTCCAGTAAAAAACACCTAAGGC
ACATAACAGACAGGACGAGCACACATTGTGTACCGGAGTA
TTTTTGCTTTTTCGTTTCGCCATCTACTGTCAGGGAGTGA
TATTGCACATTGACCTGGCTTATTGCCAGTAAAAAACTCT
TGGGTATAATTGCTAGAAAACGTCTAAAACAATGATTTTC
GATAACGTTTATCATGCTACGTGATTAAATAAATGCCTCG
TGACTAAACAAACTGCTCCAATGTAAGCGTGCACACCAAC
GCACAAAATTTAAGACATTAAAGCATACTTTAAAATAATA
AATGCCTCTGGTTCATTTTTTTAGTTTGATGTGCCATATT
AAAAACATTGGTTGACCAATGCGATTTATTTAAGGTACAG
TAAAACACCCAAGCACAAAACAGTCAAGGTGAGCACACAT
TGTGTTCCAGAGTATTTTAGTTTTTCGTTAAGCGCCATCT
ACTGTCAGGGAGTGATTTTGCATGTTTACTCTGCTCATGG
CTAGTGCAAAATCGATTGCGAATGAATGCTGAAAAAATGT
TTTGAAAAACGTTGACAATAAGTGAGAGAGAACGTGGACA
AGAAAGTCTTCAAAAATACAATCTGACGCCACCTACGTCA
CCACAAATTCTACGGCTTTCACCCTCATCAAAAAGTAAAC
TCTAAGCAGAAATCGTTGCTAATATTCTGAGTAAACAATT
CAAATCGTAAACATTAAAAACATCTTTTTTCACAGCTTTC
TCTGCTCATATTTACCAAGGGTGCTAATATTAGTGGAGGA
CACTATATGTTGGTTCATTTAGCACAATATATTAGGACTG
TTTTTTTTCCGGCTGATATCAGGATTATGGACTTCATTCA
GACCCATATCAATCCAGCGGAAGAGAAACATACCACGAGG
AAGCAACGACTAGATGTTTTCACTTGGCAACCCAAAACCG
ATTCAGTCGACGAAATACTCTTGTATCTAAAAAGGAACAA
CAGCCATTGTGTAAATTAACGAGTACTTTATGACAATGTA
TGAAGTTTTGGAGCTGAGAATATAAATTGGTGATGGATCG
TTTATAATTGTGACGTCACAGGAATGAAAACGTTAAGTAC
GGTAGACTCCAAGTCATCCATTTTGCTTCTGTCCAATTGT
AAGTATTTGTTTTCCCTCCTGGAATCATTGCGGAACGTAA
ATATATTCTCATTTTTATTGCCCCCCTGGAACAAAACGTT
TTATATAAATTTTCATGCATCAGTTTTAAAGAAAAAAAAA
AAAGGAAATACATTTCTTTAGGTCAGGTACAAGTTGTCTA
TTAGGTCTAGTTGTATTATAGTGTCCTTCGGTGAGACTAG
AAATATATAATTCCAATAATTACGATTAAAAAAAAAAACA
AATGCTTGATAGAGTTGAAAATAATCAAATAAAAAACAAC
ATACGTGTTTGGCAGTTGTTTACAAGTACATATCAGACTT
TAACCATTGTTGATTGTAAAAACAGACCAAAGCCTTTGTA
TTTCATCGGTTACACAACGATCTTAATCTTCTCTCTCTTT
TTTATCGTTAGTCTTGTGTTGCGACATTTTGTAAAGGATA
TAAAAAGTGGTTTTACATTCTAGTACACTGGCTTCGACTA
TATTTCGGCTGCGGCTTAATCACGCAGTTCTTTATTTATG
ATCGACAACCGTTTGTGGTTTTAATAACATGTTGACATTT
CTGGAATTCTGCGTTTTTTTTTTGTGTGTGTACCTGAAAC
ATGAACACTTGTAATGTTTATTTTTGTGTGTGTGTCAGAG
CAATGCTTTGGAAAATGAAAAGGTCTACCCTGTCTTGCAG
ATATTTCAATTTAACTTTATTTAAAAGCTTTCTAAATGTA
TTTTGTGAAACTATTAAAACATTTTGTACAGTA

pax6b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA pax6b-202 4993
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pax6b-202 Contained in:
[BAC] DKEY-157G7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000022984 (1),  Ensembl_Trans:ENSDART00000145946 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AF061252 (1) 1733 nt
GenBank:DN901320 (1) 907 nt
GenBank:CK017837 (1) 900 nt
GenBank:CN503412 (1) 884 nt
GenBank:CT604581 (1) 833 nt
GenBank:CK352383 (1) 805 nt
GenBank:CK396395 (1) 756 nt
GenBank:DN899810 (1) 663 nt
GenBank:DN898683 (1) 467 nt
GenBank:DN902131 (1) 297 nt
CITATIONS (2)