Transcript

opn1mw2-201

ID
ZDB-TSCRIPT-090929-61
Name
opn1mw2-201
Previous Names
  • opn1mw2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000002065 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000002065|OTTDARG00000001934|ZDB-GENE-030728-5 opn1mw2|OTTDARP00000001821 opn1mw2-001 LG_ AL732567.8 Danio rerio protein_coding KNOWN, 1661 bp
CTGGCAGTTTTGTGGAGTACAGTTTTGCTGGTGTCTTCTT
GGCATACGTGCAACACCTCCAGCAGGATGAACGGCACCGA
AGGAAACAACTTTTACATTCCTATGTCCAACAGGACTGGG
CTAGTGAGGAGTCCTTACGAATACACACAGTATTACCTGG
CAGATCCATGGCAGTTTAAGGCACTGGCTTTTTACATGTT
TTTTCTGATTTGCTTCGGGCTGCCGATCAACGTGCTCACG
CTGTTGGTCACAGCTCAGCACAAAAAGCTGAGACAGCCTT
TAAATTATATTTTGGTGAACTTGGCTTTCGCTGGAACAAT
TATGGCCTTTTTTGGATTCACGGTTACGTTCTATTGCTCC
ATTAATGGTTATATGGCTCTAGGTCCTACAGGTTGTGCCA
TTGAAGGCTTCTTTGCTACACTCGGAGGTCAGGTTGCTCT
TTGGTCTCTTGTGGTTCTTGCCATTGAGAGATACATAGTG
GTTTGCAAGCCAATGGGAAGCTTCAAATTCTCCTCAAACC
ATGCGATGGCCGGCATTGCCTTCACATGGGTCATGGCCTC
TAGCTGTGCAGTCCCCCCACTTTTTGGCTGGTCCCGATAC
ATCCCAGAGGGAATGCAGACATCCTGCGGACCAGATTATT
ACACCCTGAACCCAGAATACAACAATGAATCATATGTTTT
GTACATGTTCAGCTGTCATTTCTGCGTTCCTGTTACAACC
ATCTTCTTCACTTATGGAAGCCTCGTTTGCACAGTCAAAG
CTGCTGCAGCTCAACAGCAGGAATCTGAGTCCACTCAAAA
GGCTGAGAGGGAAGTAACACGCATGGTCATCCTAATGGTT
TTGGGCTTCTTGGTGGCTTGGGTTCCCTATGCCAGCTTTG
CGGCCTGGATCTTTTTTAACAGGGGAGCTGCTTTCTCCGC
ACAAGCCATGGCTATCCCAGCTTTTTTCTCAAAAGCCTCT
GCCTTGTTTAACCCCATTATCTATGTGCTCCTAAACAAAC
AGTTCCGTAGCTGCATGCTCAACACCCTTTTCTGTGGCAA
GAGTCCTCTCGGTGATGATGAGTCCTCCTCAGTTTCAACA
AGCAAAACAGAGGTGTCCTCTGTGTCTCCAGCGTAGAACT
AATTGCCAACTATGCTTTCTCAATGATTCTTTTAATGCTT
TGGAGTCCACTGTCTTCAATAAGCCTAAATATCCACTCCT
CAATCTCTGTATATTTTGAAAAATCACAAATAGGGCCCTA
TACTCCCCTCTCTCCCCCTTATCTCTCTGCCTTGGATCCA
TCGAGTTCAAAGAAGACATTAGCTGGCTTTCCAGACACAT
TCTCTTCGATAAATAGAGCGTGGGTAGATTAGTTGTGATC
AGCACTAGTTTATCTCACGTCTCTCCACCGATGCTTCATC
TTAAGGTATAGCTCACCACTAAATCTGAGCATAAGCCTCT
TTTCTTGTCATCATCACATCAGTAGGTCGTGACCAGAACT
GCTTTAACTCACCCAAGGGTTCAGCGAGATACGTCATCAT
ACACTGAGTTACCTTTTCACATCGACATTATGGATTGTTA
CTCCTTTATTTTTGTTTTCAGCTGATTTGTCAGCATTTCT
GTACATATTTTCTATATGGTATATTTGTTGAAAAGTAGAA
TAATAAATACATGCATTCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations