Transcript

ncf1-201

ID
ZDB-TSCRIPT-090929-6042
Name
ncf1-201
Previous Names
  • ncf1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022781 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022781|OTTDARG00000018721|ZDB-GENE-031006-6 ncf1|OTTDARP00000019039 ncf1-001 LG_ BX294180.9 Danio rerio protein_coding KNOWN, 2133 bp
AGACTCGCTCACACACTTCATCTCGCCGTCAGACTCGTTT
CATCTTCATCACAGGATGGCTGAAACATACGTGAGACATG
TGGAACTGCTTGGATTTGAGAAAAGATTCTTTCCCAGCCA
GCACTATGTGTACATGCTCCTGGTTAAATGGAGCGATCAG
TCTGAAAAGCTGGTGTACAGACGCTATCCAGAAGTACACA
CATTACATAAAACTCTGAAGGAAATGTTTCCTATTGAGGC
AGGAGATATTGACGAAAAGGACCGAATCATTCCCACATTA
CCAGCTCCTAAATGGCTGGACAATCAGAAAACCACAGAGA
CGAGGCAGGCGACTCTTGCTGAATATTGCCGATCTCTTCT
CAACCTGCCCGCCAACATCTCCCGCTGTCAGCTCATTCGG
GACTTCTTCAAAATGAGGCCTGAAGATGAAACTCCACCAG
CACCACATCCATACAAAAGAAATGAGACCTTCATTATGTC
CACAAACAGAGTACGGAGCAACACCACATCAGAAATCACA
GGGCCCATCATTCTCGAGACCTACAGAGTGATCGCAGACT
ACAGCAAGAGCTCCAAGTATGAGCTCACGCTGAAGATGGG
AGACATGGTGGACATCGTGGAGAAAAGCCCAAATGGCTGG
TGGTTTTGTCAGTGTGAGTCCAGGAGAGGATGGGTTCCAG
CTTCATACTTAGAGCCGCTTGATGGAGCAGATGAATCTGA
GGAACCGGAGCCTAATTATGCAGGAGAGCTCTACAAAACC
ACCAGAGGCTATAAAGCTGTGGAACAGGATGAGATGACTC
TCGAAGCAGGAGTCATTATTGAAGTCATCCATAAACTTCT
TGATGGGTGGTGGGTGGTCAGGAAAGGCGAGGAAACCGGC
TTCTATCCGTCCATGTTCCTGTGCAGGACGGGGGAGAAGA
AAGAGGTGGATGCTGAGAGGGACGTGGTCAGAAGAGCAAC
ACCACCACCAAGAAGGTCGACCATCCGCAATGCCCAGAGT
ATCCATTCTACGGTACGCCGGCGAATCAGTCAGGACAGCT
ACCGGAAACAGAGCCGTCGCTTCTTACAGCAGAGAGGAAG
ACTGAACTCTCATTCCAGGATCGGGACACGATCTCCACTG
CAGGAGAGGAGGACAAACAGAGAGAACATCGAGAAATCCA
GCGCTCCTCAAGCAGAAGATGAGGATAAAAGTGTTCCGGT
GGTTCCTCCTCGGCCCAGTCCTCAGCTCATTCTGGAGCGC
TGCACTGAAAACACAAGCAAGAGGATGAGCATGCAAGAGG
CTGACTGAAGCATCCCACTAAGATTTTTTATGTTTAATAG
ACGTCTAATAGACATCTAAACGTGTGTCATACATCAGCAT
CACTGTCATGGCTGCCTCCACATGAAAACATGCCAGAACC
GCTCAAACCATAGACGACTTGGCTTGACAAGGCTAAATTT
TGTCTGTCAGTGACCAATAAAAACAAGGCTAAATTAATAG
ACATCTAATAGAAATCTAAGAATAGTCCCACAACTAGACT
ATTCATCAAATACAGGGCTTGTTTGGGGGGATGTCGATTA
GATTTTCCTTTCCAGACCATATTTTGCCTTGTTTTAACCA
AGCCGTCTATATTTAGAGGTCTATTAGACGTAAAACAAAA
AATGCTTGCTGGGATCCCACAGTGCCTGCTCAACATTAAG
CTCCAATCTGCAATAGAAATGGTCACAGGCATTTAGATGC
TTACATTGACTCCTGTTTAGCCCAGAACCTGTTATAAGCT
ATGTGTATTGGACTTCTTGTATGTATGACTTTCTTCACAA
TAAATATTCTGTAGGAGAACCATTATTTGGGTTCCCAAAA
AAGTATCAGTAAATAGTTTCTAAAATAAACATTTGTATAG
TAATCGTCTGATAATGAGAAAAAACTTTTTTTTTCAACAT
ATAAAGACCCTTTTGGGCAATAGAAAGGTTCTGTGAAGGC
TAAAAGTTCTTATTGGGACCATCAGTGATAATAAGGAATC
TTTATTTCATTTTTAGAAGTGAATATTTATGACCAGCAAT
AGGCTACTTAAGTATGCATTTTTAAGATGTACTAAGTGTA
ATTTTAAATGTATTTTTACAGTTATGAATAAATAAACAAC
ATGTGAAATGCCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations