Transcript

opn1mw3-201

ID
ZDB-TSCRIPT-090929-60
Name
opn1mw3-201
Previous Names
  • opn1mw3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000002064 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000002064|OTTDARG00000001933|ZDB-GENE-030728-6 opn1mw3|OTTDARP00000001820 opn1mw3-001 LG_ AL732567.8 Danio rerio protein_coding KNOWN, 1379 bp
CACTGCAACAGATTGCATCCTCCTCGTGTTCTGGATCACT
AGCAGGCAGAGATGAACGGCACTGAAGGAAACAACTTCTA
CATCCCCATGTCCAACAGGACAGGGCTTGTGAGGAGTCCG
TACGAATATCCTCAGTATTATCTTGCTGAGCCATGGCAGT
TTAAACTGCTCGCCGTCTACATGTTCTTCCTCATGTGCTT
TGGGTTTCCCATCAATGGCCTTACATTGGTGGTAACAGCT
CAACACAAAAAGCTGAGGCAACCTCTCAACTTCATTCTGG
TCAATCTGGCTGTGGCTGGCACCATCATGGTTTGTTTTGG
ATTCACGGTCACTTTCTACACAGCCATTAATGGATACTTT
GTTCTGGGACCAACTGGCTGTGCGATTGAGGGATTCATGG
CCACACTGGGAGGGCAAATTTCCCTTTGGTCACTCGTGGT
GCTGGCCATTGAGAGATACATTGTGGTTTGCAAGCCAATG
GGGAGTTTCAAATTTTCATCCAACCATGCTTTCGCTGGGA
TTGGATTTACATGGATAATGGCCTTGTCTTGCGCAGCTCC
TCCTCTGGTTGGCTGGTCAAGGTATATTCCAGAGGGAATG
CAGTGTTCATGTGGACCAGACTACTACACCTTGAACCCTG
ACTACAATAATGAATCATATGTCCTCTACATGTTCTGCTG
CCACTTTATATTTCCAGTCACCACAATCTTTTTCACCTAT
GGACGACTTGTTTGCACAGTCAAAGCGGCTGCAGCTCAAC
AGCAGGAATCTGAATCCACTCAGAAGGCTGAGAGAGAAGT
GACCAGAATGGTCATCCTGATGGTTCTGGGCTTCCTGGTA
GCTTGGACTCCTTATGCCAGTGTTGCTGCTTGGATCTTCT
TCAATAGAGGAGCTGCTTTCAGTGCTCAGTTCATGGCTGT
TCCTGCCTTTTTCTCAAAGAGCTCTTCCATATTCAACCCT
ATCATTTATGTGCTTCTAAACAAACAGTTTCGTAATTGCA
TGCTGACCACTTTATTCTGTGGAAAGAATCCTCTCGGTGA
TGATGAATCCTCTACTGTGTCCACCAGCAAGACGGAGGTG
TCTTCTGTATCTCCAGCATAGACTTTTTGAACTTCTTTGT
GGATTATATTCGATTAGTCACTGTGCAATTCGGGCATCTG
CAAAAATAAAAAAGGAAACAAAAACAGCATTGAATTAGTT
GATCTATCTCATACGATTGTTCTAATTATGATTATTAAAC
TGGTGAACTCACAAATGGGTTATCGGTGAACATTTTTTAT
GAAGGCTGTCATTTATACTGTATCCTTGGGTTAAAATCTG
TATATATTTTGTAAATAATGATAAAAAATGGATAGGAATA
AATACTGGCATTAAAAGTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations