Transcript

cyp2p7-201

ID
ZDB-TSCRIPT-090929-591
Name
cyp2p7-201
Previous Names
  • cyp2j24-001
  • cyp2p7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000005966 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000005966|OTTDARG00000005503|ZDB-GENE-041001-155 cyp2p7|OTTDARP00000005341 cyp2p7-001 LG_ BX322665.5 Danio rerio protein_coding KNOWN, 2018 bp
GAACTGTGCCACAACTGCATTGCAAAACAGTCCAAGGAAA
GGAGTCCTTTCGAGTTAAAGCGCTGTACAGATCGTAAACC
TGACTGAAGTTCATCATGGACGTGTTGCAGTTCTACAAGT
GGCTTGACATCAAGACTGTTTTGGTATTTTTAGTTGTGTT
TTTATTTTTGAGTGATTATATCAGAAATAAATCGCCGAAA
AACTTTCCTCCTGGACCCTGGTCTTTGCCGTTTATTGGAC
ACATTCATCATATCGAGCACAAGAAGGTTCATCTTCAGTT
TTTAAAGTTTGCTGAAAAATATGGCAAGATTTTCAGCATA
AGACTTTTTGGACCAAGAATTGTAGTGTTGGATGGATATA
AACTGGTAAAGGAGGTGTATTTGCAACAGGGTGACAATCT
GGCTGATCGGCCCATTTTACCAATGTTTTATGACATCACT
GAAGACAAAGGGTTAATTGGGTCCAATGGGTATAAATGGA
AGCACCAGAGACGATTTGCACTCTCAACTTTTCGAACCTT
TGGATTGGGGAAGAAAAGTCTGGAGCCGTCCATTCTCCTG
GAATGCAGTTGTCTGAATGACGCCTTTTCAAATGAACAAG
GTCGACCCTTTGACCCTCGCTTACTTCTGAACAACGCTGT
CTCAAATGTGATCTGTGCGCTTGTGTTTAGTAATCGATTT
GACTACAGTGACCATCATTTCCAGACTCTGTTAAAACACA
TCAATGAGGTCTTATATCTGGAAGGAACAGTCTGGGCTCA
GCTTTACAACTTTTTCCCATGGCTCATGCGACGACTGCCT
GGACCCCACCAAAAAATATTTGTTCTGTTGAACAAAGTGA
TTGACTTTGTTAGAGAGAAGGTGAATGAACACAGAGTGGA
TTATGATCCTTCAAATCCTCGAGACTACATTGACTGCTTT
CTAGCTGAGATGGAAAAACTTAAAGACGACACAGCTGCAG
GGTTTGATGTGGAGAACTTGTGCATCTGTACTCTGGATTT
GTTTGTAGCAGGAACTGAGACCACCTCCACCACTCTGTAC
TGGGGTCTTCTCTACATAATAAAATATCCTGAAATACAAG
CTAAAGTTCAGCAGGAGATTGATGCTGTTGTTGGAGGCTC
ACGGCAGCCATCTGTATCAGACAGAGACAACATGCCCTAC
ACCAATGCTGTCATTCATGAGATACAGAGGATGGGAAACA
TAGTCCCATTAAATGTGTTTCGAATTACTGTAGAAGATAC
TCAGATAGGAGAATACTCTATTCCAAAGGGCACTCTTGTG
ATTGGCAGTTTGACATCAGTGCTGTTTGATGAGTCTGAGT
GGGAGACGCCTCACTCTTTTAACCCGGGTCACTTCCTGGA
CGCTGAGGGCAAATTCAGGAGGAGAGATGCCTTTTTACCT
TTTTCTCTAGGAAAGAGAGTGTGTCTTGGGGAGCAGTTGG
CGAGGATGGAGCTCTTCCTCTTCTTCTCCTCTCTGCTGCA
GCGCTTCACTTTCTCTCCACCAGCAGGTGTGGAGCCCAGC
TTGGATTATAAACTGGGTGGTACTCACAGTCCCCAGCCAT
ATAAATTGTGCGCAGTGCCACGATAAGACAGTCATAACTG
AAATATTTGTTGATGCATTGTTAATTTTCTGTTTTTAACA
GATTGATAAATGATAGTATACATAGCGTGTTACAGAAAAA
CAACAAACAACCATAATAAAAGTAACAAAAACCACAAAAA
CATAAATATTTCAAGAGCAAAGATAGATCTATGAATAGAC
AGAGTGTGTTGCAAACATTTCTCGAAGCTATAATAAAAAA
GAAACCAGAAAGACAGTACTAATAATAAGAATAATTTTAA
TGTACAGTTGAATGAAAATAATCATACATTAATATTATAT
CTGAAAAAAGGCTTGTATTTGGATATTTTTTGTATTAATA
GGTAAACAAGCAGGAGGAGATTTGAGATTAAAAATATATT
TTTTTTATATGTAAATATATACTGCTATTCATTTATTAAA
ATGTATTTTATTTGTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations