Transcript

gltpd2-201

ID
ZDB-TSCRIPT-090929-5779
Name
gltpd2-201
Previous Names
  • gltpd2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022432 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022432|OTTDARG00000018474|ZDB-GENE-060526-346 gltpd2|OTTDARP00000018797 DKEY-89J23.1-001 LG_ CR854980.8 Danio rerio protein_coding NOVEL, 1067 bp
ATTCGTTGTGGAGAGAAGAAGAATACAGAATATACTGTAT
AGGAGAAGAAAGGACACATAAGAGAGGACACTGGATGTGG
AGGAGAGATGCTGAGGAAAGAGAGAGAGAGGAGACACTAA
GACTGAGACTGAACGAGGAGACACACTAAAGTGGAAAACA
CTGAAACAGTATGGATGTCAGATGCAGGGCTTGTGTTGTT
GTCATCTTCATCCTCCTTTTGCTTGGCTCGTTGTGCCTAC
ACCGCATTCTAGAGCACCATTCTGAAGTTTACAGTGTGAA
AATCAAGGTTGTGTCTTTGGTAACAGACAACACTTCAGAT
GCTCCACTGAGCGTTTGTCCTGATCAGAGTTTTCAGATTG
CTTATTTGCTGGCTCACCTGCAAGCAGCGCCCCTCGCAGC
CAACGATGTTCTGCTGAAGCCATACTTGGCAAGCTGGGAT
GAGCTCATCAAGTTTTTAGAAGCCTTGGGGCCAATAGTGG
GTATCATTTCACAAGAAATTGAGTCAAAAACCACCATAAT
CCGTGACCTGGCACAAAAAGCGGAAGAGGAAGAGAAGAAA
ATGATTGAAAGAAAAGAGACAACTAAGCAATTAGCTCAGA
GCAAATCCTCAAACTACAGTAAAATGGACCAGACTCTGTC
ATCAGGTTACACTTCTGTTCGGTCTATGATTAAAATGGAG
CTGGAGAACGGATTGGTGGATTTCCAGACACAGACGAACT
CTGGCTGCAGGACTCTGCTGCGTCTGCACCGCGCTCTGCT
CTGGCTGCAGAACTTCCTGCATGAACTGGGGAAAGATGTG
GCTAAAGGAGAGCGTCTACGAAGGCCTTCTGACCTCTGCA
AAGAGACTTACCAGCGCACACTGGCTCGCCATCACTCCTG
GTGGGCCAGGAAAGCTGCAGAGCTGGCCTTTCTCGCTATG
CCTGAGCGATCTTATTTCTACAAGTTGGTTTGTGTGAAAA
CACAGGCAGAGGCGTCTGTGGTGCTGAACAGGGTTGTGAA
AGCAATAGAGAAGGTGTATAAGAGAAATGAAGTAGCTCTA
CAGGAACACGACATGCTGGATCTGCCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations