Transcript

ckma-201

ID
ZDB-TSCRIPT-090929-5771
Name
ckma-201
Previous Names
  • ckma-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022422 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022422|OTTDARG00000018464|ZDB-GENE-980526-109 ckma|OTTDARP00000018788 ckm-001 LG_ BX547938.9 Danio rerio protein_coding KNOWN, 1584 bp
TATCCAAATCAAACTCTTCTTGCTTGGGTGACCCCTATTT
CGGCTTGGTGAACAGGATCTGATCCCAAGGACTGTTACCA
CTTTTGTTGTCTTTTGTGCAGTGTTAGAAACGCAATCATG
CCTTTCGGAAACACCCACAACAACTTCAAGCTGAACTACT
CAGTTGATGAGGAGTATCCAGACCTTAGCAAGCACAACAA
CCACATGGCCAAGGTGCTGACTAAGGAAATGTATGGCAAG
CTTAGGGACAAGCAGACCTCCACTGGATTCACTGTGGATG
ATGTCATCCAGACCGGTGTTGACAATCCAGGCCACCCCTT
CATCATGACCGTCGGCTGTGTTGCTGGTGATGAGGAGTCC
TACGAAGTGTTCAAGGATCTGTTCGACCCCGTCATTTCCG
ACCGTCACGGTGGATACAAGGCAACTGACAAGCACAAGAC
CGACCTCAACTTTGAGAACCTGAAGGGTGGTGATGACCTG
GACCCCAACTACGTCCTGAGCAGCCGTGTGCGTACCGGAC
GCAGCATCAAGGGATACGCCCTGCCCCCCCACAACAGCCG
TGGAGAGCGCAGAGCTGTGGAGAAGCTGTCTGTTGAAGCT
CTGAGCAGCTTGGATGGAGAGTTCAAGGGCAAGTACTACC
CCCTGAAGTCCATGACTGATGCCGAGCAGGAGCAGCTGAT
CGCTGACCACTTCCTCTTTGACAAACCCGTCTCCCCCCTG
CTGCTGGCTGCTGGTATGGCCCGTGACTGGCCCGATGCCA
GAGGCATTTGGCACAATGAGAACAAGACCTTCCTGGTCTG
GGTGAACGAGGAGGATCACCTGCGTGTCATTTCCATGCAG
AAGGGTGGCAACATGAAGGAAGTGTTCAAGCGCTTCTGCG
TTGGTCTTCAGAGGATTGAGGAAATTTTCAAGAAGCACAA
CCATGGGTTCATGTGGAACGAGCATCTTGGTTTCGTCCTG
ACCTGCCCCTCCAACCTGGGCACAGGCCTGCGCGGTGGAG
TCCACGTCAAGCTGCCCAAGCTCAGCACACATGCCAAGTT
TGAGGAGATCCTGACCAGACTGCGCCTGCAGAAGCGTGGC
ACAGGTGGTGTGGACACTGCCTCCGTTGGTGGAGTGTTTG
ACATTTCCAACGCTGACCGTATCGGCTCTTCAGAGGTTGA
GCAGGTGCAGTGTGTGGTTGATGGTGTCAAGCTGATGGTG
GAGATGGAGAAGAAGCTGGAGAAGGGCGAGTCCATCGACA
GCATGATCCCTGCCCAGAAGTAAAGCGGGAGCTCTTCCAT
TTTTTTCTCGTCTTTGTCTGTTTTTTTACAGTCCAACAGC
AATGCAGAGGAAAACTGCTGCTCAAAAAGACAGTCTCACC
TTTGCACCTGTCTTCTTTCCTTTTTTTTCCCTTCTTCTCT
AATTTCCATGTCATTTCGCCATCTTTTTTTCCACTTTGTT
TCCTATTAAGTCGGTAACATCTTGGGATCAGATACCCGGC
GCAGGAGTGAGTGCCTGTTGCTGAGGCTTCACCTCAATTT
CAGCCTTGGTTGTAAAAAGTGAATCAATCAAAGTTGTATT
TCAATAAAAATACCCCATAAAACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations