Transcript

rab4a-201

ID
ZDB-TSCRIPT-090929-5497
Name
rab4a-201
Previous Names
  • rab4a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022077 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022077|OTTDARG00000018243|ZDB-GENE-040525-1 rab4a|OTTDARP00000018537 rab4a-001 LG_ CR762497.17 Danio rerio protein_coding KNOWN, 1687 bp
TCCACAAACTTCCGACAAGGATGCGCGAAACCCTCTGAGG
GATTTCCCTTTATTTGATATCCTTGTTTATTAGCCTTGAA
AGAGGAAAAACGCAGCATTACAGCCTAGAAACGCAGCGCC
AGTCATGTCAGAGACATACGATTTCTTGTTTAAGTTTCTT
GTGATTGGGAATGCTGGAACAGGAAAATCCTGTCTTCTTC
ATCAGTTCATAGAAAAAAGATTCAAAGATGACTCAAATCA
CACTATTGGGGTTGAATTTGGTTCGAAGATAATCAGCGTG
GTCAATAAGTTTGTAAAGCTCCAGATCTGGGACACAGCAG
GACAGGAGCGTTTCAGGTCTGTAACAAGGAGTTATTACAG
AGGCGCAGCAGGGGCTCTTCTAGTCTATGACATCACTAGT
CGAGAAACATACAACGCTCTGACCAACTGGCTGACAGACG
CCCGGATGTTGGCCAGTCAGAACATAGTGATCATACTGTG
TGGAAACAAGAAGGATCTGGATGCTGACCGCGAGGTGACC
TTTCTGGAGGCTTCACGCTTCGCTCAGGAGAATGAGCTTA
TGTTTTTGGAGACCAGTGCTCTGACAGGGGAGAATGTGGA
GGAAGCTTTCGTCCAGTGTGCTCGAAAAATCCTTAACAAA
ATTGAATCAGGAGAGCTGGACCCAGAGCGGATGGGTTCAG
GAATCCAGTATGGAGACGCGGCTCTTCGACAGCTGCGTTC
ACCCAGACGGGCACAAGCCGAGAGCATCCAGGAGTGTGGC
TGTTAACACACGTCCCTCTGAACAGACAGCTCAACAACCA
GGTTTTGCGAACACAAGGATGAGGAGAACATTAGTGGGGC
GTTTGATGTACGGCTCATCGTGGTGGAACGACGTTTCCCT
CACCTTACTTTTACTTCTGTTCTGACATGCCGGGGGTCTC
CCTGCGCTCCAGAAAGCCTCCGGAAATGTTTACTGTCCCC
CTCGGGCTCCAGACCAAGACATCCGTGGTACCCAAAACTC
CTGAGGGTAGATAAAAGATACTGCACTGAGCCCCTGCCCC
ATCTTTTCCCTTTTCCAAATGTAGATGTTGTGTAGAGAAG
AGTTTATATTATCACCGTGGAGCATGTTTCATGGTTGTAG
TACTACAACATATTCATAAATGACTATATACAGCAAATAT
ATATATATATACATATATAGCTTAGGCATACTGCATCACT
GCTCTTTGGCGCGCAGCTGTAAATCTTATCAAAGTTTATC
ATGTGGATTATATCGGTAGATCATTGCTTTCATTTGTTGT
TTTTTTTCTTATTGTCTGTTAAGAAAAGGCTACTGTAGTG
TTTGATTAGTGTTTTTTACAATCAGAGGCAACATTTAAAG
GGTCAACGCACTTACTTGCATATCTTACTGTAATACATTG
TATTAACAGCTTCAGTGTTACTGAATATTTATTGTTAACC
ACTTTTAACCGTTTCTTTTTTTCATGTTGCCGTCCCCTTT
GTAGGTTTTTGTTGGAATGACACTATTGTTTCTAAAGCCA
TTCCTTGTTTTCAAAAGTAAATTGCGTTTTTTTGGGTTTT
TGGGGGCGAGTTGTGGAGAAAATATTTTCTAACCTTTGCA
GTCTTCTTAACATTTAAAACATTTAAAATGGACATTTATC
AAAAAAGCTTGCATTAAAAATGTATGATTAATCAATGTGG
ACCCCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations