Transcript

tgm1l1-201

ID
ZDB-TSCRIPT-090929-5393
Name
tgm1l1-201
Previous Names
  • tgm1l1-001
  • si:ch211-9d9.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021841 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021841|OTTDARG00000018074|ZDB-GENE-060503-139 tgm1l1|OTTDARP00000018363 CH211-9D9.3-001 LG_ AL929335.9 Danio rerio protein_coding NOVEL, 2685 bp
TGTTGGTTTGACTCTTGAGGCTGTTGGAGGTTTTGCGTGC
TGTACTTCTATACATATAACATTTGAAGAACATTTTGGAT
TCCTGCGTTTACTAAAGATGCCAGGAGAAAGACAGTCAAT
TCGAGATAACTCTGCTGTCGGCCGATTCCACGGCGTTTCA
GCAAGGAATGGAGAAGCCGTCGCGGAGAAACCCAGCGAGA
GTAAAACGAAGAAACCGGAGAGCGGCTGCAGGCGCTGGCT
ACGAAAGGCTTGTCCATGCTGCTTACGCCGACAGAGCAAC
TCTTATGATTTAACCAGTGAAGCGGATGGTGTGGTTGCTG
GAAATGAAGAAATCGAACAGCCGGCGTCTCCAGTGTCTGT
CAGTGTAGAAACCAATGTGGACGATTTGTCTCTAGTGGTG
CGATCTGTGGATCTGCTCAGCCGGAAAACTGACCGTAATA
AGAAGGAGCATCACACGGATCAGTACAGTGGAGATCAGCT
GATCATCCGCAGAGGACAGACTTTCCAGATTGAGCTGGAG
CTCTCACGACCCTTCAACCCAAACACCGATAAACTACACC
TGGAGCTGAAGACAGGAGCGCTCCCACTGGTGTCCAAAGG
GACGCACATCATCATCCCACTGGTGGAGGAGCTACAGGAT
GAACGCTGGGAGGCCAAGATTGTGGAGCAGAACCTCAACC
GGGCCAAGCTGTCCATCAACTCATCCGTCAATGCTGTTAT
AGGAAAATACACGCTGACTGTCGTAACCCAGTGTCTAAAG
ACGAACGAATCTACCACACACGATCCTGAAAAAGACATTT
ACATGCTCTTCAATCCCTGGTGTGAAGATGATGCTGTGTT
CATGGAGGGAGAGAGAGAGCTGAATGAGTACGTCCTCAAT
GACACCGGCAGGATCTACTACGGCACAGAGAAGCAGATCG
GAGCTCGGACATGGAACTTCGGTCAGTTTGATGAAGGGAT
TCTGGAGGCCTGTCTGTTTGTGCTGGATAACAGTGAAGTT
CCTCCATCAGGAAGAGGAGATCCGGTTAATGTTGTCCGGG
TCATTTCTGCCATGATCAACTCTCCGGATGACCGTGGTGT
TCTGGAGGGAAACTGGTCTGGGAATTACACTGGAGGAACG
TCTCCCACCGCATGGAGTGGAAGTGTTGAAATTCTCAAGC
AATACCACAGAGAAGGAGGAACGCCGGTCAAATACGGACA
GTGCTGGGTGTTCTCTGGAGTCACAACCACAGTGTTGAGA
TGTCTTGGTATTCCTGCCCGGTCCGTAACAAACTTCCAGT
CTGCCCACGATACGGATGTGTCCTTGACCACAGATGTGTA
TTTTGATGAGGATATGGAGCCGATCCATCATCTCAACTCT
GACTCCGTATGGAACTTCCATGTGTGGAATGACTGCTGGT
TGGCACGTCCGGATCTGCCTCCTGGTTTTGGCGGGTGGCA
GGCGGTGGACTCCACACCTCAGGAGACCAGTCATGGGACG
TTTCGCTGCGGTCCGGCGTCTCTGGCTGCGGTTCGCTCTG
GACAGGTCTATCTCAAATACGACGTGCCGTTCGTCTTCGC
TGAGGTGAACAGTGACAAGATCTACTGGCAGAGAAACCTG
GACGGCACCTTCAGTCAGATCCACAGTGAGAAGAAGGCTG
TGGGTCACTGCATCAGCACTAAAGCTGTGGGCTCCGATGA
ACGAGTCGACATCACAGACGTCTACAAATACCCTGAAGGC
TCAGAGGAGGAGCGTATCGCGGTGGAAACGGCCTGTCGGT
ATGGCAGTAAGCCGGATGTGTACTCGAGCGCCATGGCGGA
GGACGTGCAGGTGGAGGTGCGGATGGAGGGAGAAGGTCCT
CGTATGGGTGGAGATGCTCAGTTGAAGATTGTGGTGAAGA
ACATGAGCTCTCAGCCACGCAGAACCACCCTTCACAGCCA
GGCGGCAGTCATGTACTACACCGGCGTGCTGAAGGACACC
GTGAAGAAGGACAAGCTCAGTGTGGAGCTCATGCCACAGG
AAGAAAAGGTCATCGAGTGGACCCTGCCTTACACACAGTA
CCAGAATCAGCTGGTGGATCAGGCTGCGCTCATGCTGACT
CTGTCTGGAAGGGTCAGTGAGACCCAGCAGGTTCTGGCCA
ACCAGACATCCTTTAGGCTCCGCACACCTGACCTCCAGAT
TGAGCCCATCGGAGAGGCGTATGTGGGTAAAGAGGCGTCT
GCCAAGATCAGCTTCACCAATCCTCTGCCCTGCACTCTGC
GTAATGTGGTTGTCCGAGTGGAAGGACTGGGGCTCCGAGA
CCTGCATCCCATCAAAGTCGGTGATGTGGGCAAGCATGGT
AAAGTAATGGTGACGGAGCACTTCATCCCATCTATAGCTG
GCGAGAGGAAGCTGGTGGCGTCACTGGACTGTAAACAGCT
GACGCAGGTTCACGGTGTGGCCGATATCATCGTTCACGAA
AGCCAGTGATTTCACACTCTCTAGCTTCACAGCATTAATT
CAGTATTCAGAACTGCATTAACCATGTTTACACTGAGCTA
CCAGGTCATTTCTTTAAAAGCTCGTCATCTTTAAAGGAGG
GACCCTCCCTTTCGCATAGTTTTATTGGAAATGTCCCACT
TTTCCCAATTGTTCCTACTGTATTTCTCTAATTTTACAGA
TCACCTATTTACAGATTATTTATTTAGCTTTGCTTTACTG
TTTGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations