Transcript

glipr2-202

ID
ZDB-TSCRIPT-090929-5298
Name
glipr2-202
Previous Names
  • glipr2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021708 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021708|OTTDARG00000017968|ZDB-GENE-030131-4424 glipr2|OTTDARP00000018261 DKEY-2N12.1-001 LG_ CR855258.6 Danio rerio protein_coding KNOWN, 3435 bp
ATTAATTTGCGATTATGAGTGTATATGTGTGTGTGTTTGT
GTGCGTGTCTGTTTAGAAGGAAACCAAGCATGAAAATGCG
TGTGTGTGTGTGTGTGTGTGTTTGTGTAGTAGGCTACCAT
CAGAATGCACTTCCCTGGTCTAGAGGGCGTTGCATCACTT
GACAGATATATAGTACGGAGATTTAATGTGCAAGACAGAG
TTGGCAGACAGCGCTTAAAGAAAGACAAATTCCTGCCTTT
GAGCAACCAACAGAACAGTTTCTCACGTAACTACATGCAT
GGCGGGCAGCAGTTTTGAGGCCGAGTTCCTACAGGTGCAC
AATGCCTACCGCAAACAGCACGGAGCTCCGCCCCTCACCT
TTAACAAAAACCTGTGCCGCTCCGCACAGCAGTGGGCGGA
GCATCTGCTTTCAACCAAAACACTCGCACACAGCAACAAG
GGCTACGGAGAAAATTTGTATTATGCTTGGAGTTCAGCTA
ACAAAAAACTCACAGGACATGAGGCAGTGGACAGCTGGTA
CGGTGAAATTAAAGACTACAACTTCAGTAGGCCAGGATTT
AGCTCCAAAACAGGTCACTTCACACAGGTGGTGTGGAAGG
ACACAAAAGAGTTGGGAGTTGGACTGGCCACTGATGGGAA
CACAATTTTTGTCGTGGGTCAGTACCTTCCCGCTGGAAAC
ATCGCAAATGCAGGTTATTTTGAAAAAAATGTCCTGCCGA
CTGGCTCTAAACTAGATCAAAAGTCCACTGGTGCAACTCA
CAAAGTGGAACAAGCTCATGGTTCATCAGGCATTCATTCA
AACAAAGTGCCCTCAGTGCCTCACATTGCTGAAAAACCAA
CACCAGAGGGCAAAGCAGAAAGCAGTTTTGAGGCAGAGTT
CTTGCAGACCCACAATGCATATCGAAAACATCATGGAGCT
CCACCCCTTACCATAAACATAAACCTGAGCCGCTCTGCAC
AAAAGTGGGCAGAGCATCTGCTGTCAATCAGGACTCTCAT
GCACAGCAACGGAGACCATGGAGAAAATGTGTATTATGCT
TATAACTCGGCTAACAAAAAACTCACAGGACGTGAGGCAG
TGGAAAGCTGGTACAATGAAATTAAAGAGTACAACTTCAG
CAGGCCTGGATTCTCCTCTAAAACAGGTCACTTCACACAG
GTGGTGTGGAAGGACTCAAAAGAGTTGGGAGTTGGACTAG
CCACTGATGGAAGCACAAGTTTTGTGGTGGGACAGTACCT
TCCAGGAGGTAACATCACAAATGCAGGTTATTTTGAGAGA
AATGTCCTACCGGGGGGATCCAAAGTAGACCTCAAAGCCA
CCCCACCTGTGGACAAAGTTGGACAAGCTCGTGGTGCCCT
TAGCATTACGTCCAACCTGTTGCCTTCATCATCTCACAGT
GTTGGACCAGCACCACCGAAGACTCATTCTCCACAGAGCA
GCCACTCAGAGAGTGAGAGCTTGTTCCAGTTTCGTCAGTC
TCTCCTTAAAGCTGTAAATGATTACAGACGACAACATGGG
GCAAAACCTCTCTCTCTGTGCCCTGTCCTCAGTAAAGAGG
CTCAGGATTGGGCAGCACATCTAGCCAGCATTGGTGCCCT
ACAGAACAGCAGAAAAGGTTACGGAGAGACTTTGTCTTAC
AAATGGACATCCAGTATGGTTCCTCCAACAGGAAAAGAGG
TTGCTGAAAACTGGTACAAGGATAATGTGAAGTACAACTT
TGCCATTCCTGGATTTCAGAAAGGAACTGGTAACTTTACC
CAGATGATCTGGAGGTCTTCAGAGCAAGTTGGTGTTGGTT
TGGGATCAGATGGAAAGGGCATGTTCATTACTGTGGCCTT
CTACAACCCTTCTGGAAACATCACCAACCCTGGCTTCTTC
CAGGATAATGTCAGACCTTCTGGGAGGTGACCTGCTGAAT
AAGAAAGATTAAGAAAATTTTGCATCTTGTTTTACTTGCT
AGTTTATAAATTTTTTAAAGGCATTTATCTCAGGTTTAGT
GTTTGCATAGTTACTGCACTTTGCCTTTGTAGGGGAGAAT
ATGGCAATATATTCATACAGTATGTTTGTCATCTAAATAT
ATATCATAAACATAAACATCAGTTCACAAATTTTAGCTGC
ACCGTTGAATGTAGATGCTTTTTTAAAGGTTCTGGTGTAG
ATAAATGAATATTATTTGCTTAGGTGGTTTTCTTTCCTTT
ACCCTAATAAGCAATCGCATGCACCTGCTATAGATTTGCA
TGATTGGTTTTAATGAGAAGTGACTTCAAATGTATAGAAA
GATGAGGTGATAAATCATAATGAAACATTAAAATGGATTT
TGCATATTATATATGTTTAAATATGTTGCTTTAATAAAAA
TGTTTGTAAAATTCAAGTAATTTCTGCAGTTTGACAGATA
TTAAACACTGAAACTTTTCACTAAACAGTGCTAATAGAGA
CTATAAGCAAAAGGGAAGATAAATTATATTTTAAAGAATC
TGTGTTACTGTACAACAAACCTGAAAATAGGAATCAAGGG
AGAAAAAACAAGATTTTTAAAGCATTTCCCTAAATTATCA
TGAAATATATTGTAAATTCAATCTGTAAAGCAGTATGAAA
ATGAAGAATGGATAAATGCACAGAACATCTTGTCAGTACA
AAAAAAACTTTGAGATATGTTGCTGCTGAAAGTTATTTAA
CCTCTTTCCTACACAGAGAGACTTGTACTTTGACTTCTCA
TTTAATAATTTTTATCCTGTAAAGACTGTATATTCTGTCT
CCCTTCCCAAAACCTCACATAAAACATTGTACATTTTATT
TTAATCTGTTTGATTTATTAGCTGTTTTCCTAAAAAACAA
ACAAACCTATATGTGATGAATACAAAGTATCCCCTGCCAC
ACACATGCACACAGACCCTCATAGATTGCATTCTTATACG
CAAATGTTTATCAACATATGCATCTAGATGTGCACATCTA
TCTTGCACAGCACCATAGAGCTTGGGTGGGAATGCGAAAT
TGAATTGACAAGGTGTCATGTTGCATAAGCCTCTCAGCAC
ATTGTGTTGCTGGAGACACATGAGATGCTCTGATCTTCAT
TTATACATGCCCTCTTTCACGAATACACAGGCTGAATAAA
ACAAAGGTCAAACACTTGATCAGCTAAAATCCACAGACCT
TTACTGTGGTGGGGGTCTAGTTTCACATTGGAAAAAAAGG
AAAAACCTTATTGAAATGTAAATATTACTTTATCAATAAT
AGTCTTTAGAATAAAACATTTCAAACAAAACACATGAATG
CTGCATTATAAAACAGGAATATGCACAATATTGAACAGCA
TTCAAGGCTTTTTCAGACTTATGCATTTGTTAATACAATT
CTACTTGAATGGATGTGTTTTGTCTGGTTAAACTGAAATT
TTTTTTAAATAAAATAAAAATTCAGTGTATTATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations