Transcript

tsc1a-201

ID
ZDB-TSCRIPT-090929-5222
Name
tsc1a-201
Previous Names
  • tsc1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021556 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021556|OTTDARG00000017866|ZDB-GENE-030131-9111 tsc1a|OTTDARP00000018144 CH211-89P1.5-001 LG_ BX276128.8 Danio rerio protein_coding KNOWN, 3687 bp
CAGCACTTCACACCTATCTGCCACTCATGCCGTGATCTTG
TGACAGCGAGACGGAGGAGTCGTTCATACATAGGCACCCC
ATGCTGACACCACAGGACATCGATTTCTGCTGTGACAAAG
GCATCAGTCCTGCCCACTGTCCTGCACAACTATGGCCAAA
GAGCAGCCAAGTGTGTTTGACCTCATCCCTCTTCTGGGGT
CCACTGACCTACATGAGCTGGAACAGGTCAAAACCTTGCT
GCAGGAAACTCTCAGTGCAGATAAAGGGACCATGTTGCTG
AATAGCCTTGTAGACTATTTCCTTCAGACAAACTCATCTC
AAGCTGTGGACATCCTGTCTTCTGTCCGGGAGCCTCATGA
TAAGTATCTTTTAGATAAGATGAATGAATGCATGGGCAAG
CAGAGCTGTCGTCTCTCCACCATCACCCTCCTTGGTCATG
TTGTTCGCAAACAGCCACCATGGATCCACAAGATCGCACG
CTTCCCTCTGCTTGTCTCGCTGCTCAAATGCCTCAAGACT
GACTCAGATGTAGTAGTTCTCATAACTGGTGTGCTGGTGC
TGATCACTCTAATGCCCATGATTCCTCAAACCAACAAACA
ACTTCTTTGCGACTACTTTGATATCTTTGGACGTCTTGCT
GCCTGGAACCAACGTCATCCAGGCCATGCTCAGGGAGTGT
TTGCAGTCCATCTACATGCCAGCGTGTACTCTCTTTTCCA
TCGTTTATATGGCATGTATCCTTGTAATTTCGTTTCGTAC
CTGCGTGCCCATTACAGTATGAAGGAAAATGTTGACACGT
TCGAGGAAGTGGTGAAGCCCATGTTGGAACATGTTCGGAT
ACATCCTGAGCTCATCACTGGAACCAAAGACTACGAGGTT
GATCCAATTAGATGGAAGAGATTTGAGCCACATGATATTG
TGATTGAATGTGCCAAAATTTCACTGGATTCTAAAGAGGC
GTCATCTGAAGAGGGCTACTCCTCTTTGGCGGATCACATA
CAGCGACGCGCTGTACACCATAGCCAATCATGTTCAGAGC
TCAGTTTCCATGAAATCTCATCAGTCACACCAATAGGTGC
TATTTGTCAGTCTCTCTCTAAATCACAACCTTATCTCACT
GTAACCCAAGACTCAGGTTCCAGCGCACAGACCCTCAACA
ATCAAAGTGATGAGGTCAAATCCTCAGGGATGAAGGAGGA
GCTGTGGAGCCCTTCCTCCATATGTGGGATGAGCACCCCT
CCCAGTTCTAGAGGAATGTCCCCAACCACAGTTTCTGACA
TCTCACTTAGTGCCTCACACCTCTCAGGACGGATCCCCAG
CACCCCAGGGGATGGAAAGTGGACTCTATCTCCCACCACA
CCCTCGGGGTCATCCCCTCTCCCATCGCTCTCAGAGGAAA
TAGGGCAGGCTGCCCAAAACACCAGCAGTACCCAGGCTAA
GACGTGCAAAGAGGTGAAGAAAGTCACATCCAGAAGTATT
AATAACAGCAGTGAGAATGGAGGTGATGCCAAGACTCCAG
TGTCGTTGGCACAGCTCTCTGACATTGTCAAAAGGACAGA
GGGGGAGCGAGAGGATGATACAATCAATGAGGAGATTTTG
AGTCTAACCCATGGGAAACTAGACTTTGGATCTAGGCCTG
GTCTGGAATCCTCATTTTCTGGCTCCTTAGACACCCTTCT
CTCATCTCATCCTAATCATGAGCAGAATTTGGTATCCACA
CCAGACAGGGTTGAATGCTCGGCTAAAGCAGGAGAGCAGC
AGCTTCCTAGGTCTCTCTGGCCGTTCACCCCCATTGAAAA
TGGGAAGCACAGTAAATGTTCTCTGTCTGATCTCACAAAA
GAATCCATGCCTTATGAGCCACTGTTTGACCTCGCCCTGC
CGAAGGTGGCATCTCTGTTTTTGGAGAGGAAGACTGCTGA
GGCCTTTCGGAGGGTTGAAGGAGAAAGAGATCACCAAGAT
GAGATGGAAGGAGAGGATCTTTCTGTCACCTCCCCTCTGG
AGGTGTTGGACCGGGTTATCCAGCAGGGTCACGACACTCA
TGGGAAAGTGCTGAAGAGAACTTTCTCTTCTCCAAGCCAA
TCATCAGACCCACACTTGAAAGGTCTTGTGCCTGCAGTGT
CGGATGAGCTAGACATGTTACGCAGTCAATTGCTGCTGCT
GCATAACCAGTTGCTTTATGAGAGACATAAGAGAGAGCAA
CATGCGCTTCGTAACCGTCGTCTGTTTGGCCGCATCGTCA
ACACTACTGCACTGGAAGAGCAAAATAACTCCATGAAAAC
GCAGCTCAAACTTCAGGAAGTTGAGATCCAGGCTGTAAAG
GTAAGCCTGAAAGAGGAGCAGCGGCGCTCTGTGCACATAC
AGGAAGACAGAGAGGCTGTCGTGAACCAGTTACAGATTCA
AATTCAGCAGTTACAGAAGGAGCGGAATGACTACTACTCA
AAGATGCAGGTGCTAAAGAGCGAGTTGCAGGAGAATCAGA
CAAAGGCTGGCAAAATGGAGGCAGAACTGCAGAAAGCCAA
TAACAAAGTGTGTAATATGGGTCACATGCTCAGCCAGCTA
TCTATCAAGCTGAACAATAGTGAAAACATGGAGCAGCAGA
TGGCTTTCCTGAATAAGCAGCTGCTGCTTTTGGGTGAAGC
CAACAAGTTATACATGGAAGAAATTGACCGCTTGGGCCCT
GAGGCGCACAAGGAGCTGAATATGCTGCAAGCATCTTCAG
TGCGGGAGGGTGAGCGTTTGAGGCAGAGCTCTCTTCAGCA
GAGTCAGAGACTTGAGGCTGCACAGCAGCGTATCACAGAC
CTGGAGAACCAACTCACCAAGAAAGAGCAAGTCATCCGGG
AGCAAAAGAAACTGCTGGACAATGTCAAACGACAGGCCAC
GGAGCAGCTGCAGGCTTCAGAAAACAGGTATTTGGCTCAG
AAGAACATCACTCAGGCATTACAAACTGAGCTGCTTGAGC
TCTATAGCAAGATAGAGCTCAAAAACCTGAAAACTAATGC
ACCAGCAGAGTCCATTTCTGATCCCAGCAGTCCCACCAAC
CAGAGGCCAAATGGCAACAGTGCAGGCCCATCTGCTCCAT
CTCTACCGGCTGACCTGATGAAAAGAGAGGAAGGGGCGCA
TGTGTGTGTCAATGGTGAAATATCTGCAGCGTCTCCTCAA
ACACCCACAGCACTCATTAATGGCAGTCAGGAAGAAGATC
TTTCCGCCCTTAGTCATTCATTTCCCTCCCTCCCCTGCCA
ACCCTTTGCAGTTGGCTCTTACCCCAGCACCAGAAGCTTT
TTGGGTAAGAAAGCCAGAGAAATGTTCCGCAATAAGAGTG
AGAGCCACTATGATGGCGACTCGCCCACCCTCACCTGCCT
CTCAAAGGATCTTAAAGTTGAGCCAATCACAGACCCCACA
GAGAGTTTGGAGTCCGAGGAAGCTGCTGACCAGTTTGACC
TGCAGCCAATGGATAGACCCCGGGCATATAATGTTCAGAG
TAGGAGGCATCAGGATCTGCGGATCATGGACTATAATGAG
ACCCATCATGTGCATTGATTGTACACTGCTGACATCATCG
TCTGCAGATAGAAGAGGATCATTTTGGACCCAGTATTAGT
ATGCACTACTCTTTTTGTTAGAGTGGTTTGCAACATTTTA
GTTCATTTTAAAAGCTCTTGTACTACAAAACGGCCAAAAA
AAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations