Transcript

klf9-201

ID
ZDB-TSCRIPT-090929-5153
Name
klf9-201
Previous Names
  • klf9-001
  • si:dkey-201c13.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021482 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021482|OTTDARG00000017819|ZDB-GENE-060526-244 klf9|OTTDARP00000018084 DKEY-201C13.3-001 LG_ BX511001.6 Danio rerio protein_coding NOVEL, 1460 bp
AGACATACAGTTGACGCACTTATGAGGGAAGAAGGGGATG
ACAGTACGCAGTAGTTCCACGCTGTCTCGTGTGGCTAATA
CAAGATTGGGAATAAGCACCTAGGATGTCCCTTCGATAAC
TTGTAGACACAAGAAACACAAGCTTTTATCCTTCTTTTGG
ACACTCTTTCATCCAAGTCACATTGGGAACGACACGTGTA
GGCGTGAAACCACGTTTTCTGGAGTCTGCTGAATCCCGAT
GCGCAGATGATGACAACCCCCCACACTGCCATTTAAGTTT
TACTGCTCTTTTACACCGGCTTACTTCTACATTTACAGCA
CATTTGGGGTGACTACGATGACGGACGTAGATATTGCAGC
AAGGTCCTTGGGGACGGTTTCAAACGTCGAGCGCTCCGAC
AAACTAACCGGCGAGGAGGGGTCTGAAGAAAGTCAAGAAA
GCCGGACTCTGTTGATGGTCGCAATGATTCTGCTGGACTT
AAACCAGTGCATACCGAGCGGCATCAGCGCCAAGCGAATA
GTGGACAGTGATGCGGAGAATCGGGAGAACCGGGAGAAGT
GCAAACAGACTGCGGGCAGGGTTAAAAGGACACGGAAGCG
CGACCGACTGCACGCATCCGCGGAGAAAAGACACTGCTGC
CCGTATGCAGGCTGTGGTAAAATATACGGCAAGTCTTCCC
ATCTGAAGGCGCACTTCAGGGTTCACACCGGTGAGAGGCC
CTTTCAGTGTACCTGGCCTGGCTGTGCAAAAAAATTCTCT
CGCTCGGATGAACTGACAAGACACTTTCGCACACACACGG
GGGAAAAGCGTTTCATGTGCCCACTTTGTGACAAATGCTT
CATGAGAAGCGACCACCTCACCAAACACGCCCGCAGACAC
GCTGGCTTCCACCCCAGTATGCTCCAGGGTCACGCCGGGC
GAAGACGACACTCTTCAACATCCACATCCTCCTCTGGCTC
CAGCGATCATATGTCTGCTGGTGTTTAAGCATTTTGACTG
TCCCTCCTACCTGACACAACACGTTCAGGAGTCTCTGCTA
GTGAGTTGGTGATGTAAGATATCAGGCGTGTTGCGTGATA
GAGACAAACAAAATATTCTGAAAACAAACAATGAATATCA
CACGTGCAGAAATCATCAAGCAGGAACAATGAATAATGAA
CTTTTAATCCGAGGGTTATTTAAAAGTGTCTTTTTTGGCA
TTTGTTGGTTCCACAAAGAACCGCCAACATCCATAAAATC
TTGCACAAGAAGTCATAGTTAAAAAACAAAACAACATGAG
ATCTTTAGATTATTGAAATGTTTTTCATACAAAAATATTT
TCTAAAAAAGATCACTAAAATGTTTTTGGGAACCAAACAT
TGTTGTTCTATTATATTGCCACAAACAAACAAGGAAATGA
AAAACCTCCCCCAGCATAAACACTGAATTGATTTCAACAC
AGAGTAAGCAGATTTTCTGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations