Transcript

eif3m-201

ID
ZDB-TSCRIPT-090929-5147
Name
eif3m-201
Previous Names
  • eif3m-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021475 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021475|OTTDARG00000017813|ZDB-GENE-040426-2643 eif3m|OTTDARP00000018078 CH211-4L14.1-001 LG_ CR936403.5 Danio rerio protein_coding KNOWN, 1275 bp
AGCATCACCGGCAAGTACACGGATCCTCTTCCGGCCTGAA
AAGCTAGGCTGCGAGCGTGGATTTTTATCTGTGCTCTTTA
AAACACTTTAAATATGAGCGTACCGGCGTTTATTGACATA
ACGGAGGAGGATCAGGCGTCAGAGCTTCGGTCCTACCTGA
AATCTAAAGGAGCGGAGATCTCAGAGGAGAATTCAGAAGG
AGGTCTTCATGTTGATCTGGCACAGATCATAGAAGCCTGC
GATGTCTGCCTCAAAGACGATGACAAAGATGTGGAGAGTG
TGATGAACAGCATCGTGTCTCTGCTGCTGATTCTGGAGAC
GGAGAAGCAGGAGGCTCTGATTGAAAGCTTATGTGAGAAG
CTGGTGAAGTTTCGTGAGGGTGAACGGCCCTCGCTTCGGA
TGCAGCTTTTGAGTAATCTGTTCCATGGTATGGACGAGAA
CACTCCAGTGAGACACACTGTGTACTGCAGTCTGATTAAA
GTGGCGGCAACCTGCAACGCCATCACCTTCATGCCTACAG
ACCTAGACCAGGTGAGGAAGTGGATCGTTGACTGGAATCT
GAACACAGAGAAGAAACACACTCTTCTCCGTCTGGTGTAT
GAAGCACTGGTCGACTGCAAGAAGAGTGAAGCTGCAGCCA
AAGTAATGGTGGAGTTACTGGGCAGTTATACAGAAGACAA
CGCTTCACAGGCCCGTGTGGACGCACACAGATGTATCGTT
CGTGCGCTGAAAGACCCAAACACCTATCTGTTCGACCATC
TCCTGGCTCTGAAACCAGTGCGCTTCCTTGAAGGAGAGCT
CATCCATGATCTCCTGACTATCTTTGTCAGCGCAAAGCTC
ATATCGTATGTGAAGTTTTACCAGAGCAACAAAGACTTCA
TCGAGTCTCTTGGTCTGTCTCATGAGCAGAACATGTCAAA
AATGAGGCTGCTGACATTCATGGGAATGGCGGTGGAGATG
AAGGAGATCTCCTTTGAGACCATGCAGCAGGAGCTCCAGA
TTGGCGCTGAAGACGTGGAGGCCTTCGTTATTGACGCTGT
TCGGACCAAAATGGTCTATTCCAAGATTGACCAGACACAG
CGGAAGGTTGTGGTCAGCCACAGCACACACCGCACCTTTG
GCAAACAGCAGTGGCAGCAGCTTTATGACACACTGTGCTC
CTGGAAGCAGAATCTGTCCACGGTGAAGAGCAGCCTCCAG
ACACTGTCTCCCACCGCCTGACAGCGCTCTTTCAGTTTTT
ATACACATTCAATAAAAGACTTATGAAGACCACCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations