Transcript

crfb4-201

ID
ZDB-TSCRIPT-090929-5086
Name
crfb4-201
Previous Names
  • crfb4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021399 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021399|OTTDARG00000017758|ZDB-GENE-070905-3 crfb4|OTTDARP00000018022 CH211-135L21.1-001 LG_ BX323875.15 Danio rerio protein_coding NOVEL, 1809 bp
AAACGTACGCTACGTACATGATGACTTGACTTTTTTCTTT
CCCTTTCTTTTTAGAACTCGCTTATTCCTCTTCCTCGTTC
ACAAGTGTCATACCCGTTCTCAGCGTGCGCACTTCATACC
AAGGGATTCTGTCAAATTGAGGAAGAATGTCCGCTTTTAT
CAGTTTTTCTGTTGTCTTGTTTAATATCATCGATGTCATC
ACAGTGTTGTCAGAAAATGTGCCAGTCCCGGAGAATGTGA
GAGTAATCTCTATAAACCTGGGATTAGTTTTGGAGTGGGA
TCCACCACAAACAACTAATAATCATCCATTTAAGTATACT
GCTGAACTGAAAGGGTGGAGGGGTTATGATCCAGTTTGTC
AAAACAGCTCATCGCTAACCTGTGACTTTACTGACAATGT
TACCATTTTTGGTTCTTACCAACTTCGTGTTCGGACAGAA
CTAGATGGAGAAACATCTGATTGGGTGGAGACTAAACAAG
TTGCAGTGGACAAAATAACTGAGATTAGTGCTCCTCATGT
AGAACTGAGAAGTAACAATGGACAAACAGAAGTTGATATC
ACTGATCCACCGATGAAAAGAAAAAACCTGAGAGACGTCT
TTGGGAATATTTCTTACCTCATACGTTTTTGGAAAAAAGG
AGAATCAAATAAGGTCAAACTAAAAAGAGAACAGAGCAGA
GTCATGTTACCAAAAGTGAAGCCTCTGGAAAACTACTGTG
TCGAAGTAGAGGTTTTGTATTTGAAGAATAAAACAAGCCA
GCCCAGCAACATGACCTGTTTAAAAAATTCGCCCAGCAAT
GAGACAGAACCCTGGCTTATAGCTGTGATGCTTTTGATCA
GTTTTCTAGTGGTGTTAGTTGCGGTTCTCCTGATCTTTAT
GGCTGTGTGGTACAGTTACAAAGGATACAGAATTGTATTC
CCTAATGATAATCTGCCAGAGCATCTAAAACAGTATTTGG
CACAACGGTCCCAGTCACCTGCACCTTTACCCATACATGA
GGGAACTCACCTGAAGGAGCCCATTCATGAGTTAATGATA
TATGAAAAGAAACTTAACAGCTCTCAGGACAATCAGCAAA
TAATATAACAATTATCGTTTCAGACAAATAGGAGGATTGT
ATTTGAGGTAATGTAAATAAATGTAATGATAAATGTAATA
AAGAGAAACTTTTTTTTTTTTTTTACACAACAGAAGTTTT
GCTTACCATAATCATATTACAGTTTTTAAAATTGCTAGCA
TACATTTGCCCAATCTGTAGCCACATTTTCAAAACACTAA
GTGAAGTTTAATAAACTAATTTCAAGAGGAGCACGTGATA
TGCACCGCTGGCCACTCATCCGTAATCAGTAAAAATCCAA
TCAGAATGATCCTAGCTTAATATAAAAGGATCACTTTCTC
CTTATTGCTCTATATTCGTTTTGGAAGAATCCCCCCTTCC
ACCACATCTCCTCCTTTTTTCTCCTCTTTTAAAGGGGGAG
TGATCAAGACCTACCTGATCTCGGTTCTCCTGATATGCTT
CTAGACCGGGCGGGAGCCCTGGGCTCAAATATCTCCGAGC
TCAGGGTTCTCTCCCGGGACAGCATGCCAAACCTGCTATA
AGTGCCAAGCATATCTAAGTGGAAACGCTTGAAACACAAT
TAGCACAACATTAGTATATTGTGACCATACCATTACAGTT
TTTCTCACTTGATTAAACACATGTCTTGAAACTATGCCTC
ATATTCTCAAAATAGTAAACACAAAGCCATAATGTATAAC
CAAATTTCCCAAACATCCTATTTAAGGTCAAAATTAAGCT
CTTTCCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations