Transcript

si:ch211-212o1.2-202

ID
ZDB-TSCRIPT-090929-5039
Name
si:ch211-212o1.2-202
Previous Names
  • si:ch211-212o1.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021343 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021343|OTTDARG00000017718|ZDB-GENE-041111-310 si:ch211-212o1.2|OTTDARP00000017982 CH211-212O1.2-001 LG_ CR387935.16 Danio rerio protein_coding NOVEL, 2249 bp
CAAGAAAGGTGTGTCATTCACCGCTAAACCTGAACCCCTG
TGTATTAATTACTAAATGCACGATACAGGGTCATTATTAA
TGCATTTTCTCTGAAAACTGGCCATCATAAGGGACCATGG
CGGCGGCGTTACTGTCAGAGACGGAGATCAGGCATCGGTC
TATGGCGGAGGAGGATCCGAACGGGAATGAGCACGGGGCG
GCCGCGCGCAGCACCGCACCTCGCTGGGGACCACAGCACG
CCGGGGCCCGACAGCTCGCCAAGCTGTACTCTCCGGGAAA
GAGACTCCAGGAGTGGATCTGTGTAATTCTGTGCCTCTCA
CTCTTCATTGTAAACCTCTCCTTCCTCTTCCTCAACTTCT
CCACTGTGCACATCTACAGAATCATCTTTGGCATCGTGAC
TGGTATTGTGACAGCAGACTTTGCCTCTGGGATGGTCCAT
TGGGGAGCTGATACATGGGGTTCAGTGGACATCCCAGTAA
TTGGGAAGGCATTTATTCGCCCATTCCGGGAGCATCACAT
TGATCCGACGGCTATCACACGGCATGACTTCATAGAGACT
AATGGAGACAACTGCATGATCACCATCCTGCCTCTGGCCC
ACATGGCCTATAAATTCCTCTCCTACCCACCAGATGCCCT
TGCAGAGTCCTACCCCTGGGAATGTTTTGTTTTTGCGTTG
GCGGTTTTTGTAACCATGACTAATCAGATCCACAAGTGGG
CTCACTCCTACTTCGACCTGCCACGCTGGGTCACACTATT
GCAGGACTGCCACCTAGTGCTGCCCCGCAAGCACCACCGG
ATCCATCATGTGTCGCCGCATGAGACTTACTACTGCATCA
CTACAGGCTGGTTGAACTATCCGCTGGACAGAGTGGGCTT
TTGGCGGACAATGGAGTGGCTCATCGAGAGACTGACAGGT
CAGAGGCCACGCAGTGATGACCTGGCCTGGGCTAAGAAAA
CTGACTGACCGGGCCAACATGACTGAAGCCCTTACTGAGG
GCGAGCAGGAACTGCATATGGGCCTTACCTAAATACCCCA
ATATGTCCCTCCGTTTCCCTCAAACCTTCTTCTCCACAGC
AAACCACAGATTACTGCTCTTACTGTGGCCTTTTTTCTCT
CACACCGCCAGTTCCTCCTCTGTGTTTTGTCAATGTTCAC
ACACAACAAGAAGATGAGGTATAAAACGGTGGGTAAAGAC
TGACAGGACACACTTTCTCTTAAAATCCTTCACATGCACA
GCTTTTCTCATTTGAGTGTGCAAAATGTATGTTTTCTGGA
GGTTGGGCTCTCCAGAGGACTGAAACCATGTTGTGATTTC
CCACAGCATGGTTTTCATAGCAGTGCATGGAGCGAGAGAA
GCAATTAAATGTGGATTTGATTTTGGAAAATGCGGAAAAA
GAGCAAACATTTCTTCCAGTTTCACAAGAGGAGGCGTTTA
AAATGCTTCCTTCGTTTGGACGGAAGGACACACCGAGGAT
GGCTTTGTTAAAACGCAGGGAAAGGGTTTTGTTGGTCAGT
GCTTCGTTGACCCAACTGAATGTTTTCCCTGAATGTTTCT
GACTGAGCTCGTGTTGGCCTTAAGTACAAACCCATTACAC
TTATTTCTAATCAGCTTACCAGGGCTTAGCGGTGATGAAC
ATTGATTGCGTCTCTGGTGTGTTAGTGTGACTTGTTATTG
ATATATGGAGTAGTATTAGCAGTCTAGCTAGTGATGTCCT
CCTGCTGTATTGTGGTACGGCGGTTTAGCAAAGGTTGTGC
TAACAAAAGGTCACTTTGGAAAAGGTCACATTGAATCGGG
ATTTTTAAGTTACAGAGCTTTATTAAAGAGAATCATTAAT
GTGTTTTATTTTTTCCTTTATTTATATTTGCACTGTATAT
GACCAGCGATACATTTTCATGTGAAATTAATGCGGAAATC
GGCCAAATATGATCCTATTTTCTTTATTGCACATATGCAG
GTGGACACAGGTTTCCTTCACAGAGCACACTTGTATGAAT
TACCTGCTGATTTATGTCTTTCCGGTTGATAAATGGAGAG
AATATGACTTTTTAACGAGGTGTTTTGGTACGGATTTTCT
CACATTCTTAACTGCTTCACAGTCTGGACTTCATGTGTTT
TGACATTACGGTGTAACCGTATTTGTATTTGTTCTTAAAT
GTCCATCTTGCAGCTAATGCTCGCTGCTAGTCTGCCTTAA
ACCAATGTTTTTATTAGCTGTTTGATTTAATAAATCTCTA
ATAAATACG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations