Transcript

hoxd4a-201

ID
ZDB-TSCRIPT-090929-4982
Name
hoxd4a-201
Previous Names
  • hoxd4a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021041 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021041|OTTDARG00000017438|ZDB-GENE-980526-214 hoxd4a|OTTDARP00000017731 hoxd4a-001 LG_ BX322661.17 Danio rerio protein_coding KNOWN, 2288 bp
AATATTAATTTACAAAAAATGTTATACACTCACACACACA
TGCTTGGTTATGTGGCATGAGAACATGTTTTTATGATAGC
ATCTAATGTGTAAATAGAGATCCTCCCATATGATGATGAA
CAATTGGCTATTGCATGAGTCCCAGCACTGCTTTCCTCCT
TGTCTCTTTCTTTTATATGGGTATTTAATCAATAAAATTT
TATATTGTGTTATTTCCATCCTAATTGAGAGATAATGTGA
AGTTTGTAAAAATCACTACTAGGTGTGCACAGCTTCTTCT
CGGTTGATGAAGTCCCTCCACCTCGATTGGCCAAGCTGGT
CACATGGTAGGCTAACTTTATTCAGTTGACAGCAAGTAGG
AGGGCTTTATGGAGGGAGGAAAAAAAGACAACTCGAGAAA
AATTAGTATTTCCTACCTTCAGAAATTAATGGCCATGAGT
TCGTACATGGTGAACTCCAAGTATGTGGATCCCAAATTTC
CTCCTTGCGAGGAATATTCTCAGAACAGCTATATACCTGA
ACAGAGCCCAGGCTACTACAGTCCGTCGCAGGACACTGAT
TTCCAGCATCCCGGAATCTATTCACGGTCAAACTACTCTG
AACAGCCTTACAGTTGTAGCACTGTCCAGGGCTCGTCGGT
GCAGCCGCGGGGTCATGTGCAGGATCAAGCCAGCACCCCT
AGCCCTTTCCCTGCACAGACAGAGCAGTGTCCCGCGGTCC
AGATTTCCGGATCGAGGACTGGTGGACAACAACAAAACAC
AAAGACCCAGAACGGGATACCAACGAAGCAGCCTGCTGTA
GTTTACCCGTGGATGAAGAAAGTGCACGTTACTACGGTGA
ACCCGGATTACACAGGACCTGAACCCAAACGTTCTCGGAC
AGCCTACACAAGACAGCAGGTTCTCGAACTAGAGAAGGAG
TTTCATTTTAACAGGTATCTAACAAGACGGCGTCGCATCG
AGATCGCGCACACACTCTGTCTTTCTGAAAGACAGATTAA
AATCTGGTTTCAGAACAGGAGAATGAAATGGAAAAAGGAT
CACAAACTACCAAACACGAAAGGAAGATCGGCATCAGTTG
GAAATCAGCATGCACAACACGCTCAGAAGGACAGCCAGAC
AGAGATCACAACTTTATAAGTGGATATCTCTCCCTCCCTT
CAGATGTACAGATGAACTGTATGTAATAGACAATGCTTAA
TTTGACATTGCATGGTAGAAAATCATGACATGTTGGGTCT
AAGTGCCAAAAACTGAGAAGCTGAAGCACACACCATGACT
TAATGCAGCGTAAAAGCTGCTTTGCGTTACAATTCCCAAT
ATTTCAAATATTGTAACCCTTTGTATGAGAGGCAAAGAGG
ATATGAGGCATCGAATGATGGTTCACAAATCACCACGAGG
TACAGTAAAACGTCATAAAGCTTACGATTTTACACAAACT
TGCCAAATTTATTTGAGAGCATGGTCTTTTAGTGATCCAA
TTCAATTCGTTATTTTGGAAAATCTCTGTATTTTAATCAC
AAATGTCCTTTTTTAAAGAAATTATGGCAGGTTTATGCCT
GTGGCGCGCCAGTTTATCTTAACTTAATCGTTAGACAGAA
CTTAAGCAAGGCAATACCCCCCGTATAATTAACTATGAAT
GTTTACCGCTTTTTTTGCATTAAAGTCGACTGGGTGCAAA
TAATATAATAAAAAAATAAAATGAGTTTAATAGTAGAAAA
AATATCCTTGCCTGGTGAAATTATTTATTCGTGAACTGAA
AGGTGAACAAAAATATCCCCGAAGCCCTCTTTCTGTGCGC
GCCTCGTTTGCTTACTTTAAGACTATTTCAGTCTTTAATT
TTTAACTTGTGTATATTTTATTAAAAATTCGTTGCAGATG
ATTCTCAGTTGTTTACTGCAGCCTCTTGTCCTATTTAATT
CAATAAGAAAATATCTTTTTTAACACGAATATTCCTTGCC
TTACACTCCACTATAAATCCCGCTCGGCATCTTTGTAAAC
AAATAGCTACGACTAAAGTAGCAATCTATCCGTCTTCCAA
ATGTTGCCTGAAGTTCTTGAAAAGCAGCTTTTTATTTAGC
ATTTTAGACACACGTTTAGCCCTCCAGATGTTTGAACCTT
CTATTTATTAAATATAATGTTAAAAGCTTTATGTTGTGAA
CGTAATTATCCGTTCCATAATTATCAAATTCCGTTTTTAA
GTTCTTATATATGTATATATTTCTGTATATTGTGCATATT
TTCTACAGGCATATTTTGCAGTAATTAAATAAATATATGC
AGAGGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations