header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4971
Transcript Name: zc4h2-201
Previous Name: zc4h2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021016 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021016|OTTDARG00000017419|ZDB-GENE-030131-2207 zc4h2|OTTDARP00000017708 DKEY-286F3.4-001 LG_ CR812469.6 Danio rerio protein_coding KNOWN, 1737 bp
GACAAAACCCTTGAGTGATTTTTTAAACGCGCGCTCCCTT
TAAACCTCGCCGAGAATTGTGGGAAATGTAGTCAGCGGGT
GTTGCTGTTGTCCACAGCTGGTTAGCATTTCCATTGTCTT
TCTTATGAGAGGAATATCCGCTACAATCGTCTCTTCTTTT
CTTATTCCAACACACGTCTTACCCTTTCTTAGTCCACCAT
GGCGGACGAGCAAGAGATAATGTGCAAGCTAGAAAACATC
AAAGAAATAAGGAATAAGACAATTCAGATGGAGAAGATCA
AATCTAGACTGAGGACCGAGTTTGAAGCTCTGGAGTCAGA
AGAAAAGCACCTGAGAGAGTACAAACAGGAAATGGATCTT
CTGCTGCAAGAGAAAATGGCTCACGTAGAGGAGCTGCGGC
TCATTCATGCGGATATTAACGTGATGGAAAACACTATCAA
ACAGTCAGAGAGTGACTTGAACAAACTGCTGGAGTCCACC
AGACGTCTCCACGATGAATACAAGCCACTGAAAGAGCATG
TGGACGCCCTGAGGATGACCCTCGGCTTACAGAGACTTCC
AGACCTCAGCCAGGAAGAGGAGAAACTCTCGCTGGACTAC
TTTGAAAAGCAAAAGGCTGAGTGGCAGACAGAACCCCAAG
AGCCCCCTATTCCAGAATCCCTGGCGGCGGCGGCAGCTGC
AGCCCAGCAGCTTCAGGCTGCTCGAAAACAGGACGCCAGG
CAGACGGCAACGTTCCGACAGCAGCCGCCACCAATGAAGG
CTTGCCTTTCCTGTCACCAACAAATCCACCGGAATGCACC
GATCTGTCCTCTCTGCAAAGCCAAAAGCCGCTCACGCAAC
CCTAAAAAACCCAAGAGAAAACCTGACGAGTAACATACAG
TGCTTTCTACAACCTTGGAGAAAACCTGACCAACACACAC
GACCCCAACAGAAAATGATCCACTTATATAAACACACTCA
CTCATGCTCTCATGCATGCACATTCCCAAACACACACAAA
CACACATTTACTTTCATACACAAACACTCCATTGTCCTGG
AGAAATGGACCATCTGCAGTCTGATAACTCGACCTCTCAT
AGTGATCCTGTAGTTCAATCTGTCTTCCTGGACATGAGGT
CGTCGTTTTTCATTTCAGTTTTCTATAAGTGAACCCTTGA
TATCGTGTTTGTACCGTGTCTGTATTTAGTCGCTAGTGGA
AAAGGATGCAGGTTTAGAAATATTGGAGTGTACTGTCGTG
CGTGGGGTTTTATTCTAGTGCATTAGTTCAAAACTAAACT
CTCTAAAGTGGCTTTAGTCATCAGAGCCGGTTGTACGGTA
TTCATTTATTACTTTAATAAGGTTAATTGATTATTAATGG
TATGAGTTTACATATGTCATTTTGTTTTATGATAATAGTG
CGTATTGTTTTTGTTGTATTGTGTTCTGATGGTTTGAACA
GAATTAGCTTTTACCTTTAAATGTGGTGCTAGTGGTATGT
GATTGGGGAAAAGAGGGAACAATAAAGAATTAGATGCAAC
AGTGAAATATTGAACATATTTGGAAAGTGGCATATTTCTG
GATTCTCTTGAAACCATTGTTCAATTTGACTGAATGAGCT
GTTAATTTGTATTTGACTGAAAGGGCATTATGAGCTTGTT
TGAATATTCAGTATTGAAGTGTTGTGTTTGTGTCTCATCT
TTTTCTGAGAATCTTTTTTTGATAATAATAACAATAATTA
AAATCTGTGAAGCTAAA

zc4h2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA zc4h2-002 (1) 627
mRNA zc4h2-201 1737
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zc4h2-201 Contained in:
OTHER zc4h2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000021016 (1)
  • Ensembl_Trans:ENSDART00000020908 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC053110 (1) 1710bp
    GenBank:AY648796 (1) 1682bp
    GenBank:CA469685 (1) 905bp
    GenBank:CK868472 (1) 858bp
    GenBank:CN321776 (1) 856bp
    GenBank:CK704899 (1) 855bp
    GenBank:CK146366 (1) 840bp
    GenBank:BI889330 (1) 800bp
    GenBank:CV483104 (1) 797bp
    GenBank:CV483091 (1) 783bp
    GenBank:BI886435 (1) 689bp
    GenBank:DN895308 (1) 675bp
    GenBank:BM571943 (1) 552bp
    GenBank:BM571711 (1) 459bp
    GenBank:AI588348 (1) 388bp
    CITATIONS (2)