Transcript

ldlrap1a-201

ID
ZDB-TSCRIPT-090929-4894
Name
ldlrap1a-201
Previous Names
  • ldlrap1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000020797 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020797|OTTDARG00000017255|ZDB-GENE-030328-13 ldlrap1a|OTTDARP00000017545 DKEY-264P5.2-001 LG_ CR954168.11 Danio rerio protein_coding KNOWN, 1490 bp
AGGAGGTTCAAGTATTTCCACAGATGTCGGCATCCAAACG
CCAACAACAAAGTTGAGGGAGCGAGAAGCCGTAGTTCATG
GCCAGCAAGCTGCACCTGAAGACGCCTCACCGCTTCTAAA
CTCGCCATGGATGTGCTGAAATCAGCCAGAAGGGCTTTCA
TTCGCAGCCCCAGCCTGACCAAACAGTCCTGGAGCTCAGG
CAAACACAAAAAATTGCCTGAGAACTGGACTGACACAAGA
GAGACTCTGCTGGAGGGAATGACCTTTAACCTTCGACATC
TGGGGATGACACTGGTGGACCAACCTAAAGGAGAGGAGCT
CTCAGCTGCTGCTGTCAAGAGGATTGTTGCCACGGCCAAA
GCCAGTGGGAAGAAACTGCCTAAAGTGGCCCTGAAAGTGT
CTCCTCAGGGAATCATCTTGTACGACAGTGTGTCAAACCA
GTTGATCGAGAACATTTCCATATACAGGATATCATACTGC
ACAGCTGACAAGACGCATGACAAAGTGTTTGCTTTCATCG
CCCAGAACCAACAGAATGAAACTCTGGAGTGTCACGCATT
CCTCTGTGCCAAACGGAAAGTGGCCAAGGCGGTCACGCTC
ACGGTGGCTCAGGCCTTCAGAGTGGCCTTCGAGTTCTGGG
AGGTTGCCAAAGACGAGAAAAAATGGGATTCAGCTGGAGA
AACATCCAACAGCTCACAGTCTGACCGATCTGTCAGCCTG
ACCAGCCTGAAAGTAGGAGCTGCAGCAACAGAGAACCTGT
TGGAAATCGAGGACTACACATCGGCTTTGGAAAATGTTGA
CAACCACACCGAACCCAACAACAACACCACCACCCTATGG
GAGATGGATGATGGTCTGGAAGAGGCTTTTTCAAGACTCG
CTGAGTCTCGTACTAACCCCCAGGTCCTGGACATTGGGCT
GAGCTCTGAGAGTGAATGGGATGAAACCAATGGAAACTCG
CCAAATGCCAATGAGCTCTGCGGCTTCTGAGCACAGATCC
AGAGCCTGCGTTCAGTCTGGTCCTGCTCATCCCTGTTATC
ACCACACCAAAGCAATATCAGATGAGTCTATTTTTGCTAA
AGGAAAAAAAAGTGACACTGCGCTGAGTTTACATGCTTTA
TTTTTATCAATCAAGTTGTATACAGAATATATGTAGATAC
CAGAGTCAGTATTGTTTTTCATGTATGAAAAGGAAAAAAG
TTTATGGTAAATATAACATTGTGTATATACAGGTGCACTA
TAGAGTTATTTTAGAGTCTAACCCTGTAGTTTGCTGCTTC
AAGATTCATTTATCACCACAATGCCCTTCATTAATAATAT
GGAAATCAGCGTTAAAGTCACAGTACTGCTTGTCATTTGA
GGATTGTGAGTTGTGTGTCAGTATTTACTTGTATGTTTTT
TTTCTATTTAATCAGAATTGTATTATTGTTATAACACCCT
AAGGGGCCATATAATATTTCTCTAAAAAGTCTAATAAAAG
TGTTAATATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations