Community Action Needed: Please respond to the NIH RFI
Transcript

stmn2b-201

ID
ZDB-TSCRIPT-090929-4848
Name
stmn2b-201
Previous Names
  • stmn2b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000020698 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020698|OTTDARG00000017177|ZDB-GENE-050522-207 stmn2b|OTTDARP00000017489 stmn2b-001 LG_ BX927165.19 Danio rerio protein_coding KNOWN, 1822 bp
CACCGCTGACAAGCTCCTGTACATTAGACCGGGCGCGAGA
CAGCCTTTCACTCGGCGCTGCGCGTTAAGGGACAACAGCA
GCCAATCTGACTGAACCCACGCCCGCTCCTCATCCCTGAA
GCCGCACTCTTTCCCTCAGAGCGTCGATCTGCTGACTCAG
TGCCTTATCAGAACCAACCGGTTCCTCGCCACCGAATAAA
GCTGAGACGCACCAGTCACCGACACAACTCCAGCCATGGC
CAAAACTGCGATCGCATACAAAGAGAAGATGAAGGAGCTT
TCCCTCGTCTCCCTCATCTGCTCCTGTCTCTACCCAGAGG
CACGCAAGAACATCATGGGCGAGTTTGAAGACATGGAGGT
TAAGGCCATTAATAAGCGGGCTTCAGGTCAGGCCTTTGAG
GTCATCCTGAAGCCTCCTTCTCCAACAACTGAAGGAGGCT
ACAGCATCACTTCACCTCCGAAGAAGAGGGACATGTCACT
GGAGGACATCCAGAAGAAGCTGGAGGCAGCTGAGGACAGG
AGGAGATCCCAGGAGGCTCAAGTCCTGAAGGCTCTGGCTG
AGAAGCGTGAGCATGAGCGGGACGTCCTACTGAAAGCCAT
GGAGGAGAACAGTAACTTCAGCCGGATGGCAGAGGAAAAA
CTGATCCTGAAGATGGAGCAGATCAAGGAGAACCGTGACG
CACACCTTGCAGCAATGATGGACCGACTGCATGAGAAGGA
GAAGCACGCTCAGCTGGTGCGCAGAAACAAAGAGCTGAGG
GAAGAACTGACAGCATGAGCACATCTCTACATCCCCCACC
CCCCTCCCAATACCTGCGACCCCACCCTTCTCACCCCGCC
ACCGCTATCCCATGTAGAAAAGAGCCTCTGACACCCCAAA
TCCAACCCCCCTTCTGCCCCGTCCCGCCCAGGCCAAGGGA
ATCGACCCGCCCCCCTCACCAACCGCATCCTCCCCATTAT
AGTCCATAAGACAAAAGGAACACAATGTTTTTGATCAATT
CCAAACCAGTCAAAGTGGGTGTGGTTTTTTTGTAAATACT
TCCTGTTTGTTTTATATGAGACGATGAAAAGTATTGCGGT
GTGCCATTTTTTAAAAGTTTCTCTCTGTATCTTTCTCTTT
TAGTGGATGTACTTGTTTCTTCTTCTTCTTCTTCTTCTTC
TCTTTTTCTCGATCAAATCTGCTACAGTTTCTCTCGTACC
AGGCTTTGGTGTTTGTGAGTTTGCTGGATAGCTGACATTT
GCAACGTCTTCTTGAAACCCAACGTTCTCTGATGTCTGTT
TGGAAAGAATAAAAGACACCACAGTACAGTACCGTACAGG
TTGCAAACAATATTTACAAACAGTCTCTTACAAAGTCTTC
ATACATCCATACAGTGGCATATAGTCATGACACAAAGACA
CACACACACACACTCATATAAATGAGTTTAGTCAGCATGA
TTTCCATGTTGCTCAAGAGGAGTTGTGAAATTAGCCATGG
TTAAGTCATATGATGTCTCTTGACCCCTGTTTGACCAGTC
TGGGTTGTATTTGTATTGACAGCGTAACAGAAAGTGAGTT
CTTGAGAATTGGGTATTGTTCTGATTCTTCAAAGAATTTT
TGGAGGGTGTTAAAATTGATGTGTAAGTGTGTGTGTGTGT
GTGTGCGTTTCGAGAACAGTGCGGGTGGACGGTGTTATAA
TGTGCCATTGCTCTTGTGTAAGTCACCAAACCAGCCCACC
CTCATCTTTCTCCTCCTCCAGCTGTGTGTTTTCTTCCCTT
CACACATGTAACTTTGGGAGCAAGCTGTGGTGAATAAAGG
CTTGGGATTCTTGGAATGAGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations