Transcript

lamc1-201

ID
ZDB-TSCRIPT-090929-4774
Name
lamc1-201
Previous Names
  • lamc1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000020500 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020500|OTTDARG00000017017|ZDB-GENE-021226-3 lamc1|OTTDARP00000017315 lamc1-001 LG_none BX571812.8,BX681417.10 Danio rerio protein_coding KNOWN, 6133 bp
GCATCCTTCAGGCGGAAGTAGACGTAGGGATTTTTTTTTG
GAAGTGCATTGACTTGCGCACTAGCTGCCAGGGTGTAGTC
GGATATAGTTGCTTTTCTCCAAAACTTTTTTTCTCCATGG
CGCTGGTTACAAAGCACGAATAAAGTGAAGGTTTGTAGGA
GAGAAGTCGCGAGGAGGTTTAAAGCCGCAACTATAATCAC
TTTTCCGGAGGTGAAGCGACTACCACCATTTTCCGCATGA
GTTTATTTATAAAGCCACAAACTCGGTAGCTGGCGAGTTA
CCGCAAACTTTTTTTTGAAAGACTGCGAGGATTTAAGGGA
TCAAGACAGTGACGGTAGCAACTCGAGGTCGCAATAGCAA
AAGGACACAATGTCGCTTTTTAGCTGTTTGTTGTTATGGA
CTTTGTGGGCAGCGTGCAGTCACGGAGCGATGGATGAATG
TATAGACGAGGATGATCGGCCTCAGCGCTGCATGCCGGAG
TTCGTTAACGCGGCTTTCAATGCGACCGTGGTGGCCACCA
ACACTTGCGGCTCGCCGCCTGAAGAGTTCTGCGTACAGAC
CGGGGTTACGGGAGTCACTAAATCATGCCACATTTGCAAT
GCCGCGGACCCCAGACTGCACCACGGCGCTGTTTATCTCA
CCGATTACAACCAACCAGTGCAACCAACCTGGTGGCAAAG
CCAGACTATGTTAGCGGGCATCCAGTACCCGAACTCCATC
AACCTGACCCTTCACCTGGGCAAATCTTTCGACATCACCT
ATGTGCGTTTGAAGTTCCACACCAGCCGTCCTGAGAGTTT
TGCCATCTACAAGCGCTCCAGTGAAGACGGGCCTTGGACC
CCCTACCAATACTACAGTGGCTCCTGTGAAAAAACCTACA
GCAAAAACAACCGTGGCTTCATCCGCACAGGCGAGGACGA
GCAGCAGGCTCTGTGTACAGATGAGTTTAGCGACATCTCG
CCACTCTATGGAGGAAACGTGGCTTTCTCTACGCTCGAGG
GCCGACCCAGTGCATATAACTTCGACAACAGCCCTGTACT
GCAGGATTGGGTAACTGCCACTGATATCAGAGTGACCCTG
AATCGATTAAACACTTTCGGAGATGAAGTTTTCAACGATC
CCAAAGTCCTCAAATCCTACTACTACGCCATCTCGGATTT
TGCTGTGGGAGGAAGGTGCAAGTGCAATGGCCATGCCAGC
GAGTGCGTGAAGAACGAGTACAGCAAGCTGGTGTGTAACT
GCAAACACAACACAGAAGGAGCCGACTGCAATGTGTGCAA
ACCCTTCTATAATGACCGTCCCTGGAGGAGAGCCACTGCT
GAAAACCCTAATGAGTGTCTGCCTTGTAACTGTAATGGAA
AGAGCGCTGAATGTTACTTCGACCCTGAGCTGTATCGTGC
CACTGGTCACGGAGGTCACTGCCGTAACTGTGCTGACAAT
ACAGATGGGCCGAAGTGTGAGCGATGCCTGGCCAACTACT
ACAGAGAGGCCTCCGGTCAGCGCTGTCTGTCCTGCGGCTG
CAACCCTGTTGGGTCTCTCAGCACTCAGTGTGATAACACT
GGCAGATGCAGCTGTAAGCCAGGAGTGATGGGAGACAAGT
GTGACAGATGCCAACCTGGATACCACTCGCTCTCTGAGGC
AGGATGCAGACCGTGCTCTTGTAATCCAGCCGGAAGCACA
CAGGAGTGTGATGTCCAGACCGGACGCTGCCAGTGCAAGG
AAAATGTGGACGGATTCAACTGTGACCGGTGTAAACTGGG
CTATTTTAATCTGGACCCCCAGAATCCTCAGGGCTGCACT
CCATGCTTCTGCTTCCAGCATTCGACAGTGTGTGAGAGCG
CAGACGGCTACAGCGTGCACAAAATCACCTCCACCTTTGA
CAGAGATGATGAAGGCTGGAAGGGTAAACAGAGAGATGAC
TCCAGTGTACCGGTACAGTGGTCACCCAGTTCTGGAGAGA
TCTCACTCATCTCAGAAGATTACTTCCCCATCTACTTTGT
GGCTCCAGATAAATTTCTGCATAATCAGCTGTTGAGTTAT
GGTCAGAACCTCACGCTGAACTTCAGGATTCAGCGTCACG
ATGCTCGCCTCTCAGCAGAGGACGTTGTGCTGGAGGGCTC
GGGGCTTCGTGTCGCTGTGCCTCTTATTGCTCAGGGTAAT
TCCTACCCAGGAGAGGAGACCCAAACCTTTGTGTTCAGAC
TACATGACACAACTGACTACCCTTGGAGACCCACCATAAA
GCATGCAGACTTCCAGAAACTTCTCTACAATCTGACTTCA
ATCATGATCCGTGGAACCTACAGTGCACAAAGTGCTGGTT
ATTTGGATAACGTGTCTCTGGTGACTGCCCGCCGGGGCCC
TGGCACTCCGGCCCGATGGGTTGAGAAATGCACGTGTCCG
CAGGGTTATTTGGGTCAGCATTGTGAGCAGTGCGATCAGG
GATTCAGGAGGAGCCGGCCAGAGCTGCGACGCTTCAGCAC
CTGCGAGCGCTGCAACTGCAATGGACACAGCGACACATGT
GACCCTGAGACAGGAATGTGTAACTGCCAGCACAACACTG
CTGGTCTGAGCTGTGAAAGGTGTAAAGACGGCTTCTATGG
TGATTCTACAGTGGGCTCTTCTTCAGACTGTAAAGCCTGT
CCCTGCCCTGCCGGTGCCACCTGTGCTGTGGTGCCCAAGA
CGAATGAGGTGGTCTGTACCAACTGCCCGACTGGAACCAC
AGGTAAGCGATGTGAGCTGTGTGACGATGGTTTCTTTGGA
GATCCTCTGGGTGAGAAAGGTCCAGTGAGAGCGTGTCGAG
CCTGCAGCTGCAACAACAACATCGACCCGAACGCTGTGGG
CAACTGTAACCGAGAGTCGGGCGAATGCCTCAAGTGCATC
TACAACACCGCTGGCGTCTTTTGCGACCGCTGCAAGCAGG
GCTTCTACGGTGATGCCCGCGCTGCTAATGTAGCCGACAA
ATGCAAACCGTGCAAGTGTTCTCCATATGGTACAGTAGAC
CGACAGACAGCCTGTTCTCAGGTGACGGGTCAATGTCCGT
GTCTCCCTCACGTCATTAACAGAGACTGTGGCGCTTGTGA
ACTGGGTTTCTACAATCTGCAGAGTGGAAAGGGCTGTGAA
CGATGCAACTGCAACCCTATTGGTTCCACGAATGGTCAGT
GTGACATTGTCAGCGGTCAGTGTGAGTGTCAGCCTGGAGT
CACCGGTCAACATTGTGAGCGATGCGAGGTCAACTTCTTC
GGATTCAGTTCATCGGGTTGCAAACCATGTGACTGTGACC
CAGAAGGCTCAGAATCAGCTCAGTGTAAGGAGGACGGCCG
CTGTCATTGTCGGCCAGGTTTTGTGGGCTCTCGCTGTGAT
ATGTGTGAGGAAAACTACTTCTACAACCGCTCGACACCTG
GCTGCCAGCAGTGCCCTAACTGTTACAGCCTGGTCAGAGA
CAAGGTAAACCAGCAGAGACAAAAACTGCTTGACCTGCAG
AATTTGATTGATAGTCTGGACAACACTGAGACGACAGTGA
GCGACAAGGCCTTTGAGGACAGACTGAAGGAGGCAGAGAA
AACTATAATGGACTTGCTGGAAGAGGCTCAGGCTAGCAAA
GAAGTGGATAAAGGTCTTTTGGACCGTCTAAACAACATCA
ACAAGACCCTGAATAACCAGTGGAACAGACTGCAGAACAT
CAAGAACACAGTAGACAACACAGGAGCACAGGCAGACAGA
GCACGAAACCGCGTTCGTGATGCAGAAAACCTGATTAACA
CAGCCAGAGAGGAGCTGGACAAAGCCAAAGAAGCCATCAG
TAAAGTGGACATTAAAATACCTACAACCTCTGGAGATCCA
AACAATATGACGCTTCTGGCAGAGGAAGCCCGTAAGCTGT
CAGAAAAACACAAAGCAGATGCAGATCAGATTGAGAAGAT
CGCGAAAGATGCCAATGACACTTCTACTAAAGCCTATAAT
ATGCTGAAGAAAGCACTTGATGGAGAGAACAAGACAAGCA
GCGACATTGATGAACTCAACAGGAAGTATTTGGAAGCGAA
AGATCTGGCCAAAAATCTGGAGAAGCAGGCAGCTAAAGTT
CATGCTGAGGCAGAAGAGGCCGGAAACAAAGCTCTGAAGA
TCTATGCTAACCTGACCAGCTTACCTCCAATCAACACCAA
AACATTAGAGGATGATGCCAATAAGATTAAAAAGGAGGCT
TCAGACTTGGACAAACTGATAGACAAGACTGAAAAGGAGT
ACAATGACTTGAGAGAAGACTTGCGAGGAAAAGAGACGGA
GGTCCGCAAACTGCTGGACAAAGGAAAGACTGAGCAACAG
ACGGCTGATCAGTTGTTGGCGCGTGCAGACGCAGCAAAGG
CTTTGGCTGAGGAGGCGGCAAAAAAAGGCAAATCTACTTT
CCAAGAGGCTCAGGATATTCTGAACAACCTCAGAGATTTC
GACAAGCGAGTGAATGACAACAAAACTGCTGCTGAAGATG
CCATGAGGAGAATCCCACAAATCAATGCAACAATCAATGA
AGCCAATGATAAAACCAGACGGGCCGAGGCGGCTTTAGGC
AATGCAGCTGCTGATGCTAAAGATGCTAAAGCGAAGGCAG
AGGAAGCTGAGAAAATCGCTAATGATGTGCAGAAGGGTTC
TGCAAAGACCAAGGCAGACGCAGAAAAGGCTTTTGAAGAC
ACCATGAAACTGGATAAAGATGTTGACAAAATGATGGACC
AGCTCACAGCAGCGGAGAAAGAGCTGGAAAAGAAGAAAGC
AGAGGCGGACACTGACATGATGATGGCATCTATGGCATCA
GACAATGCCAAAGATGCAGAGGGCAATGCCAGAAAAGCCA
AAAGTGCTGTCAGAGAAGTACTCAACACAATCAATGCACT
GCTAGGCCAACTCGGTAACATCGATAAGGTGGATCTGAGC
AAGCTGAATCAGATCGACAACGCTCTCAAAGATGCCAAGG
ACAAAATGGCGGGAAGTGAGCTGGACAGGAAGCTGAAGGA
GCTGAACGACATCGCCAAGAGTCAGGAGGACATGATCAGC
GACTACGACCGTCAGATCCAGGAGATTCGAGCAGACATTG
CCAACCTGAACGACATCAAGAACACTCTGCCCGAGGGCTG
CTTTAACACGCCGTCTCTAGAGCGGCCATAACCTCCTACA
GCAACCTAACCTAACCTCCAATCCACAGCGCTACGTCTGC
CTTACACTCCACCAAAACGGCCTTTCCCAGTCTTGCCTTT
CGTTTCCTTTTACTAGCTTACTGTTCGTATTTCTACACGT
TTCTTGGAAATCATCTTTTACAAACGGAAGACAAAAGCAG
CTTTTAATTGTGATATGCAGAAATGCTACGTGAAGAGAAA
TCCAAGTTATGGCGCTCACCAGCCGTGTGTGTGTTTGTGT
GCGTTTGTCTATGTATGTGTGTGTGTGTGTGTGTGTTTGC
GTAGTAGCAAGAGGTAAGAGGCCACATGACTGCACCACCT
CCAGTTCTTCTTCTCATACTTTTACAACACAATCTGAATG
ATAGTAAAGCGTTTGTTTGAGGAAGTTTGCTACTTAAGCT
AGTGTATATCATCATCATCATCAGTAACGCTATTCGCTCA
AAGCTAACAGTGAAGGATTCTTAATTTGCTCTATTTTCGG
CCCTCGTTTTTAAAGTGTCACGTACATACAGTATTTCAGT
TCATGTATATATGAATAGTTCAACGCGGAGAATGAAAGTC
CCTGCATGGAGCGCGACATTTCAGTTTTGCGTTGTTATTT
TTCAGACGCTGCTGCTGCTGCTTTATTAAAGGTGTCCTGC
GATTCGCATTAACACGAAAAACACGCAAAACTCAACACTA
TGCAACTTTGTACATTGGCGTAGCAAGACTTTTATCTGAT
ACACTGGTGCTAATAATTATTTCAAATGTTATATTTTTGT
GTGAATGTTATTTTTTTTCTTTATTTTTTATTATTATAAT
ATAGAGTTGAGGAACTGTTATTTGTGTAAATATGCTTCAA
TGATTCAGGAATGGCTGATTTTTTATTTTTATTTTTTAAC
TCAGCCAGCCACCTCACCGGTTCACAAAATAAAAAATCAG
CTAAAATTTCTTGCATAATATATATATATATATATATATA
TATATATATATAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations