Transcript

abcb9-201

ID
ZDB-TSCRIPT-090929-4569
Name
abcb9-201
Previous Names
  • abcb9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019785 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019785|OTTDARG00000016454|ZDB-GENE-050517-12 abcb9|OTTDARP00000016717 DKEY-21K4.3-001 LG_ AL929297.10 Danio rerio protein_coding NOVEL, 2742 bp
ATGAGGGTTGCTGTGATTGTTAGTTGCAACCTGGTTTTTA
CTCTAGTGGATATTGTGCTTACCACGGTCTTATATATACA
TGGATCAAACATTGATATATTTTCAGATGAAACCGAAGAC
TTTGACATACATCGCTCAACTGTGGACTTGTGGGGAACAG
TTCTTATACGGGTCAGTCTTCTTTTCGGGGCTTCCATTGG
TGTGTTCTTCAACAGGAGAGATGGCCCTCGGAGAGTGTCA
AACCTGGGGACTCTGGTGGCTCTCATATGCCTTACCAACA
TGACTTACGCTTTGGCCAAGCTGCTGATGCTTTCTGAGGA
GGGAAACCTGATGTATGACCCCTGGTTCCTAAGTTTGTTC
TCCTGGACCTGCGTGGCAGCTATAGGAGTCATGATCTTCT
GGAAAATTTTGTCGCAGACTCCCAATGCTGTGTCTGACAG
AGAGGACAGTGAGGACACGGAGAGACTAGTGGACGAGACT
GAAGATGAGTCTGAGAAGAGCATGAAATCAGGGAAAGAGC
ATACACATTCAGGGGCCACAATCGGCCGTCTGCTGTCGTA
CTGTAAGAAGGACTCCAGTTTGCTGAGCATCGCTTTCTTC
TTTCTTCTCCTCTCAGCTGTGTGTGAAGCTTTCATACCTT
ATTACACAGGGCAAGCAATAGATGGCATAGTTATCCAGAA
AAGCATGGATCACTTTGCCAAACCAATGATTACTCTCAGT
GTGTTGGCTTTGGTCAGCTCCATAGCCATTGGGTTTCGTG
GCGGAGTCTTTTCTGTGACGTTTGCCAGATTGAACATTCG
ACTTCGCAACCTTCTCTTCAGATCACTAATGCATCAGGAG
ATCGGATTCTTCGATGCCAACCATACAGGTGACATTACAT
CTAGACTTACCTCAGACACTACTCAGGTCAGTGACCTCAT
CTCACAAAACGTGAACCTGTTCCTACGTAGCTTTGTGAAA
GCTGTGGGCATCTTCATATTCATGTTTGGGATGTCCTGGA
AACTGTCTGTAGTCACTATCATGGGCTTCCCATACATAGC
TGTGGTCTCCAAGCTGTATGGAGAGTATTATAAGAAATTA
ACCAAAGAAGTCCAGACGGCACTGGCTCAGGCCAATAAAG
TGGCAGAGGAAACTATATCAGCCATGAGAACAGTGCGAAG
TTTTGCAAATGAGGATCAGGAAGGAGACATGTACTACAGC
AGACTGCAGGAGATGTTCGTTTTAAATAAGAAGCAAGCCA
TTGCCTATGCCTGCTTCATGTGGTCCAGCTATATTTCTGA
GCTGGCCTTACAAGTAGCAATCTTGTTTTATGGAGGCCAT
CTAGTGGTGACAAATCAGATGAGCGGCGGGACACTTATTT
CCTTTGTTATCTACGAGCTGGAACTTGGAGAGGCTCTGGA
GAGCATATCATCGGTGTACACCGGTTTGATGCAGGGTGTT
GGTGCTGCAGAGAAAGTGTTTGAATATATTGACAGGAAAC
CTAAACATGCCCTTAATGGCCAAGAAGCTCCAGAGACACT
GGAGGGGCAGGTGGAATTCAACAACGTGACATTTGCATAT
CCGTCACGTCCAGAGATGGATGTATTGAAGAATGTATCCT
TCAGTCTTCGCCCAGGGCAAGTAACTGCACTTGTAGGGCC
CTCTGGTGGTGGAAAAAGCTCATGTGTGTGTTTGCTGGAG
AACTTCTATGCCCCTCAGCAAGGCCAAGTGCTGGTGGATG
GGCGACCTGTGAACACTTACCAGCACAAATATTATCACTC
CAAGGTGGCACTGGTGGCTCAGGAACCTGTTCTGTTTGCC
CGTACTGTTCAGATGAATATCTCCTATGGTGTACCTGAAG
CTCCCATGGAGGCGGTTATCAGGGCTGCCATCAATGCCAA
TGCACATGACTTCATAACAGGCCTCTCTAAAGGATATGAC
TCTGGGGTCGGAGAGAAGGGCACTCAGCTCTCTGGTGGGC
AGAAACAGAGAGTTGCCATCGCCCGAGCTCTCATCAGAAG
CCCTCGCATTCTCATTCTGGATGAAGCCACAAGCGCACTG
GATTCAGAAAGCGAATACATAGTTCAGCAGGCTCTGAACA
ACTTGATGCGGGAGCACACAGTTTTAGTGATTGCCCACAG
ACTGAGCACAGTGGAGAGAGCAGACAACATCCTTGTGATC
GACAAAGGCTCTGTGGTGGAGCAGGGCCCTCATGCTGAAC
TCATGGCCAGAGGAGGCCTCTACTGTAAGCTGGTGCAGAG
ACAGATCCTGGGCACTGAAATCGATGTAGATGATAAAAAC
CCATCGCCAGCCCCAACATGGGAGCTAAAGACAGAAGATA
AGGAGAATGCAGAGGACTGTAGTGACACAGAGTATGAAAC
ACGCTACTGAGAGCCAATCATTTTGTGCTTTATATGATTA
TTGGTATGAAGGCCTTAATACTAGATTTGTTTACTTGATC
GGATATTGGGATATATCAGATAATGTGCATGTCAAAGAAT
GTTTACTACAAGACTGGGGGACTGCCTTGAATAATACTTT
AAGCAATAAATACTTGATGCATCTGATGTACTGTATATTA
GTTTTAAATGTGTATATCTTAATTTAATTGTATTATTCAA
GTTATAGAAATAAAACATATGGATGGATGGAAAATAATTC
TTGTTTTTTTTTTAATGAGCCAGTATACAGTAGAATAGGA
CTATTTTTTTCATTTATTTAATTTTCATATTTTATTTTAA
GGTTATATATGTCTGGGTGTAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations