Transcript

si:ch211-283g2.1-202

ID
ZDB-TSCRIPT-090929-4240
Name
si:ch211-283g2.1-202
Previous Names
  • si:ch211-283g2.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000018885 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000018885|OTTDARG00000015759|ZDB-GENE-060531-57 si:ch211-283g2.1|OTTDARP00000015950 CH211-283G2.1-001 LG_ CR407559.8 Danio rerio protein_coding NOVEL, 2570 bp
ACTACTGCACATACCTGAAGGATGGCGGCGAAAGAGGAAG
CCGGCAGACCCACATGGAGCAGGCAGATCGAGTTTACGCT
GGCCGGCATCGGCTGTGCTGTGGGACTGGGCAACATCTGG
AGGTTTCCATACCTGTGTTACAGAAGCGGAGGAGGTGCGT
TTCTGTTGCCGTACCTGCTGATGCTGGTGGTGCTGGGGAT
CCCACTGCTTCACATGGAGCTCACTCTGGGCCAGTATCTG
AGAAGAGGGCCCGTCCTGGCCCTGGCCAAAGCCTGTCCAC
TGTTCAAAGGTGTTGGCATGGCAACGGTGGCCATCTCTTT
CATCATGTGCACATACTATAATATAATCATCACGTGGGCC
CTCTACTACATGTTCAGCTCTTTTCGGAGTGAGTTGCTTT
GGCAAAACTGCAACAACACGTGGAACACGGTGAACTGCAC
CGACCAAGTGACCAACAGCTCCTCGTCCTCCACCGCCAGC
CAGCAGTTCTTCAACTATAAGGTGCTGGAGAGAACCAGTG
GTGTGGAGGAGACGGGCACCTTGAGGTGGGAGCTCTTCCT
CCTGCTGCTGCTGGCCTGGATCCTTGTCTACCTCTGTATC
TTTAAAGGAGTCAAATCCACTGGGAAGGTTGTATATTTCA
CTGCTCTGTTTCCATACGTGATTCTTCTGGCTCTGCTGAT
CAATAACGTGCAGCTGCCGGGAGCTTTAGACGGCATCAAA
TTCTTCATCATACCCGAGTGGGACAAGCTGCTCAACGTGC
AGGTATGGATTAATGCAGCAGCTCAAATCTTTAACTCCAT
TGGGATTGGCTTTGGCTCGCTCATGGCGATGGCCAGCTAC
AACAACTACAATAACAATGTCCTCAAAGACACTCTGGCCA
TCGCCATCACAAACTCCCTGACTAGTATTTTCGCTGGATT
TGTCATTTTTTCTGCGTTTGGCTACATGTCGCACCTTCAG
AATGTGCCGGTCAGTGAAATCGCAGTTGACGCTGTGTCTC
TGGATTTTTCTCCGGCAGGTCCGGGTTTAGTGCTTGTGGT
TTACCCACAAGCCTTTGTGACGATGCCTGTTGCTCCTCTT
TGGGCCTTTCTCTTCTTTTTCATGCTACTCTGCCTCGGCC
TCGACAGTCAGTTCGCTATGGTGGAGGTGATGGTGACCAG
TCTGCTGGACAGTTACAGTAAACCCATACTGAAGCACCTC
AAACGCAAGGAGTTTCTTGTGCTTTTAGTTTGTGGTGCGG
CGTTTCTTTTGGGTATCCCTAATGTCATGCAGGTTGGGAT
CTATGTGTTCCAGCTGATGGATCATTACACAGCCATCGTC
TCCATCATGTTCCTGGCCTTCTTTGAGGTGGTTGGTGTTT
GCTGGTGTTATGGTGTCAAGCGGCTGTCCAGTAATTTAGT
AGAGATGACAGGAAAGAGACCCAGCATTTTCTTCAGGATC
TGCTGGTGGGTCATTTGTCCTGCGTTGATAACCGTGATCC
TAGTGTTCTCAGTCATTCAGTTCAAACCAGCGCGGTATGA
GGATTATGTGTACCCACCGTGGGCTCAGGGTGTTGGCTGG
CTCATCGCCCTGGCGTCCATCATCTGGATTCCCCTAGCAG
CAGTGCACACGCTCTGGGTTCTGCCCGGATCCTTCACTGA
GAAGTTTAAAAAGTCCATCACACCATTTTCTCTGGATGAG
GATGATAGCCCATATTACCAGCAGAAAGGTGGAATTATGG
AGACGATTCCCAACATCGCTGTCATCAGTCCGATTGCACC
GCTGCCTGATAAACCAATCCAGACTAATTTATGATCTGCT
AATGAATCACTGAACAAGACTGCTGGACACCAGAACTGCT
TGAGGTTTATTCAGTGGACAAGTCTGAAATGTTGAGAGGG
GTCTGGATGCAGACCTGGTGCAGTGCAATTTTGGTTGCAT
CCAATGCTTTTTAATGTGCTCACCTAACCCCACCCCTCAC
AGTGATTTCACTAGCTTCATTGCATTGTGTCTGACATTGC
ATGGCTGAGTGATGCAATCTCAGCTTGCATCATAAAAGCT
GCATCCAGATACTATTGATTGGCCTAAATTCTAGTTTTAA
TAAGTATAGCTATCTTTAGGATCATCTCAGTTATAATAAG
CACAACCAATTTGGGGGTTTAAAGGGGTAGTTCACCCAAA
AATGAAAATCCTGTCATCATTTGCTCACTCTTCACTAGTG
CCAATCCTGTTCAAGTTTCTTTCTTCTGTTAAACACAAAG
GAAGATACAGTATTTTGAAGAAAGCTTTATCCATTGACCT
TCCTAGTTTTTGTTGTTCCTACTATGGAAGTCAATAGCTC
TGTTTCCATCCAAAAATGCAGATTAACTTTGTTCAAAACT
GGATTATCGCATAAAAGACGTACAAATAAAGCAGCGTTTC
TATCCAACCAGTCAAAGCGAACAAAATTGTCACTTCCTGA
TTAACTGGCGCCAAATATCAACATTAAAAACAGAATTTGC
TACGATAAGAGAAGCTGCTTGAATCTTTTCTTCATTTACT
AAACGGCTTGTGCCTCAGAAGACAATCCTGACCATAATTT
TAATGGGATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations