Transcript

glipr1b-201

ID
ZDB-TSCRIPT-090929-4086
Name
glipr1b-201
Previous Names
  • glipr1b-001
  • zgc:65887-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000018459 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000018459|OTTDARG00000015406|ZDB-GENE-040426-1459 glipr1b|OTTDARP00000015586 glipr1b-001 LG_ CU855696.7 Danio rerio protein_coding KNOWN, 1787 bp
CGCGCATTAAACATTTTTCGTGACATGGTGGGTGGTTCTG
TTTCGGTTCTTTAAAAAGCCCCTGTAAAGGCAGACAGACA
GACACTGGGAGAGAGAGAGCGACAGACACAGAGGGAGAAA
GAGAGTGGGCAAATCCACGGCGCCATGACGCACAGGTCAG
CGCGTCTCCTGCAGTGATGCTCCATTGACTCATTTATCCG
GAGCGAAGCAGCGGCTCAGGACACTCTCCTCCTGCCATGG
ACTCTCTCGGCGGTCTCCTCCTGCGGATATCGGTTGTTCT
GTACGGCTCCTGCAGCGTTCTGGCGCTCTTACCGGGAATC
ACGGAACCGGAGTTCATCCGCAGGTGTGTCAAGGCGCACA
ACACGCACCGCGCGCGCGTCAGTCCACCTGCGGCCGGTGC
GCGCTCCATGTCCTGGGACAAAGAATTGGCCAAAGGTGCG
AGAGATCGAGCGAGACATTGCAAGGGCTCTCATTATCCTA
GTCTGGGACATTTCGGGCACCCTCTGTTCGGGTGGATGGG
TGAGAACATCTGGCTGGGGTCTCCGTTTTCAGCCTTCTCA
GTGGAGAACGCCGTACACCGATGGAGCAAAGAAGGAGCAT
ATTCAGTCAAAAATAACAACTGCTCGAGGCTGTGCGGACA
CTACGCACAGTTAATGTGGTCTACAAGCTTCAAGATGGGC
TGTGCAGTAAATGTGTGCTCCAAAGGAATCGAAAACTTCT
CCACCCACCCGGAGTCCACTATTTTTGTGTGCAACTATGG
CGATACAGGACAAGTTCATGGTGTAACTCCATATATGGCA
ATGGGCTGCAGTGGATGTGGATCAGAGATCTGCAGAGACA
ACGTTTGTAGATATGATTGGTTCCCTGGCTGGGATTATGG
TCCGCCCTCTTCAGCCCACAGTGTTTCTTATTGGCAGACT
AATCTTGGACTGTGCCTACTAGGAGTTTGCTGGCTACTGC
ACTTTTATGCAACACATTAATGTCAGTCTGTGAACCTGTT
ACACAACATCTTTAAATCTCCCCATCATGTCTATTCATAT
TCAAATATTATTCACTATTAATAATCAACATGATATGAAG
AAATCTATTTATAACTTTAAAAGAAAAAAAAGGATATACA
GCTAGGAAAAAAAATAAAAGGCTACTTAAAAATTCTCAGT
TTCTCTGGATTCACTGAATCAATTAGGTGTGGGTTTGATT
AAAAAAATGTTTTATTTCAAAAAGGTTTTATAATGTCTGA
ATAAAAGGTTCTTTAATGTCCCGATTTCAAATACAAATAC
TGTCTATTAAAGCTCTATTTTTGCAGAAAATGGTCAAGAT
GACACTTTTTTGTAAATTGTTGTGTGTGAAAACGATTTAT
TCCAGCAAATATTGATTTCTTAAGTCATCTTAAGTTAAAT
TATTGGTATTGTGTTGTCTTAAAATAATAAACCTGTCTGA
AAACACAGCATCTTTTCTATCTAATCCTGATTTTCAAATA
CAACAAATCCAAATCCATTCCAAAATTGTTATCAGACCAT
TACTGGGTAAAATAAATATTGACAATCTACTCAAATTCAT
TCATATTAAGTCCAGGAATCTAAAGAAACTGAGAATTAAG
GTGGTGTTTTTCCTGTGGCTGTGTATATAGTGTTCATATA
AGTTCCCTTTCTGCTGTGTGTAAATCATTTATTTTATTTG
CCATATACACAGTAGCTCTGTAAATGAATTTGATTAGAAG
AAAAAGTTATGTTTGATTTCATGAAAGTGCTAGTTGAATA
AACTCGGGTTGATATTTTATACTATCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations