header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4080
Transcript Name: hpcal4-201
Previous Names: hpcal4-001, si:ch211-215a10.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018441 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018441|OTTDARG00000015388|ZDB-GENE-060503-307 hpcal4|OTTDARP00000015570 CH211-215A10.5-001 LG_ BX510301.6 Danio rerio protein_coding NOVEL, 576 bp
ATGGGAAAACACAACAGCAAGCTGGCTCCTGAGGTGCTAG
ATGACTTGACCAAGAGTACAGAGTTCAATGAAGCCGAGCT
GAAGCAGTGGTATAAAGGATTCCTGAAGGACTGTCCATCT
GGCATCCTCAATCTGGAAGAGTTCCAGCAACTCTATGTGA
AGTTTTTCCCTTATGGAGATGCTTCAAAATTCGCCCAGCA
TGCCTTTCGGACATTTGACAAAAACGGTGATGGTACCATT
GACTTCAGAGAGTTCATCTGCGCGCTGTCCATTACTTCCA
GAGGAAGCTTTGAGCAGAAACTAAACTGGGCTTTCAACAT
GTATGATCTGGACGGAGACGGTAAAATCACACGCATGGAG
ATGCTGGAGATCATTGAGGCAATCTACAAGATGGTCGGCA
CAGTGATCATGATGCGTATGAACGAGGATGGTCTGACCCC
ACAGCAGCGCGTGGACAAAATCTTCAGCAAGATGGACAAG
GACCACAACGATGAGATCTCACTGGAGGAGTTCAAAGAAG
CGGCCAAAAGCGACCCCTCCATTGTGCTTTTACTGCAGTG
TGACATGCAGAAGTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hpcal4-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000018441 (1),  Ensembl_Trans:ENSDART00000103506 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CF265703 (1) 888 bp
CITATIONS (2)