Transcript

hpcal4-201

ID
ZDB-TSCRIPT-090929-4080
Name
hpcal4-201
Previous Names
  • hpcal4-001
  • si:ch211-215a10.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000018441 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000018441|OTTDARG00000015388|ZDB-GENE-060503-307 hpcal4|OTTDARP00000015570 CH211-215A10.5-001 LG_ BX510301.6 Danio rerio protein_coding NOVEL, 576 bp
ATGGGAAAACACAACAGCAAGCTGGCTCCTGAGGTGCTAG
ATGACTTGACCAAGAGTACAGAGTTCAATGAAGCCGAGCT
GAAGCAGTGGTATAAAGGATTCCTGAAGGACTGTCCATCT
GGCATCCTCAATCTGGAAGAGTTCCAGCAACTCTATGTGA
AGTTTTTCCCTTATGGAGATGCTTCAAAATTCGCCCAGCA
TGCCTTTCGGACATTTGACAAAAACGGTGATGGTACCATT
GACTTCAGAGAGTTCATCTGCGCGCTGTCCATTACTTCCA
GAGGAAGCTTTGAGCAGAAACTAAACTGGGCTTTCAACAT
GTATGATCTGGACGGAGACGGTAAAATCACACGCATGGAG
ATGCTGGAGATCATTGAGGCAATCTACAAGATGGTCGGCA
CAGTGATCATGATGCGTATGAACGAGGATGGTCTGACCCC
ACAGCAGCGCGTGGACAAAATCTTCAGCAAGATGGACAAG
GACCACAACGATGAGATCTCACTGGAGGAGTTCAAAGAAG
CGGCCAAAAGCGACCCCTCCATTGTGCTTTTACTGCAGTG
TGACATGCAGAAGTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations