header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4079
Transcript Name: si:ch211-215a10.4-201
Previous Name: si:ch211-215a10.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018439 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018439|OTTDARG00000015386|ZDB-GENE-030131-5518 si:ch211-215a10.4|OTTDARP00000015568 CH211-215A10.4-001 LG_ BX510301.6 Danio rerio protein_coding NOVEL, 1924 bp
GTGGCAGTATCACTTGTTGGCCACTGGATGTCCCTCTAAC
AGGCGGATTCTGCTTCTAGAAGGTGTCGTGCGCACGCGCT
CTGACGCAGGCTGGCGCTGGGCAAGGACATAAGGAGAGTG
ACATTTGTATAACGTTAACAAGAAACTCGCATTCTTTCCT
AAATCCCACATAAATTTTCGTCAGCCACATTTGGATACTC
CCACACATCTATGCACAGCGCGTTGACGCTCAACAGCATC
TCGTATGATTCACTGAGGACAGGTTCTGGAGGACTGAATT
CACACTGTGAATGAACGAATAATTAGAAGCAGTGGTGGAT
GGGAGAGCGCACCTTTCTTGCTGTTGATGTCATCTTTCTA
AGACTCGTCGAGGTGTCCTCAGCACCCTGACTTGAATGGC
TGTGTGCAGAGGGGGCGTCTCTCTTTGGGTGGGGTGTGTC
AGGAACCATGGCGGAAGGCAACCAATGACAAAACAGTGCT
GGAATTTATGTCAGACAACCGAGTTTCACTTAAATGACAA
CTGTAGGACCCTGAGCAGTGCATCATGGGCCTTGGCTCCT
CCAAATAGTCTACGTTACCTGTCCATTAAACAGCCAGCCC
TGTCCCATCCCTTCCACCATGCATGTCAGCCCAACCGATC
GGCCAACCTCGAAGAAGAGGAATGGGAAGAGACCGTCAGC
TTGCAAGTCCTGTTCAAACCTGGAAGAAGCCATGAGCAGC
ACATGGTGGTGGAAGAGCCCTTTATTGGGCCTGCCAAATT
AAGCGAGCTCCTTGCTCTGGGACCCAACAGACCTTTTGAC
TTGCTTTTTCCTTTAACCACTGTTGATGGAAGCAGGGAGG
ATGATATTAGCATTATTGGAAATGCAGGGACTGCGGAAAA
GGAGCTGATGGAGTCTCCTTCAAGCTCCTTCAGGAGTCTC
TTTGAGACTGAGGGATGTCCTGCGCCGTTTATGCTGGGAT
CTCGCTTCTATTGTTTTCACTCCTCTGTTTTGGAGATCGG
GAACCAACCAGGAAAGGGACAAGATGAGTGGAGCTTCTAT
CCAGCCCTCCATGTCACACATTGCAGCCGTGATGAGACTG
GGAGAGCGGACAAGAGCTCCAGCCAGAGAGACATGGAGAA
TGAGGAGAAACTGGCCCTGATGCATGAGAAGCTGAGGGTG
GAGCTGCCCAGATTCTTTAGGAAAAATCATGACTACAGCA
TATACTCTGAAGATGTTGAGTTCATCAATGGTCTTCTGAA
CACCAAGACAAGGGGTCGTGTGGTGTACCAGCTGACTCTA
ACTCTTTGGAAATTGATGTGTCTCTTCTACTATGCCGATG
CTCAGCTGGAAGTGCTGAAGCTGACCAAGCATCCAGAAGA
CGGCTCCATCAAAGCTCGCTGGAGAGTCAAAGGCCTGCCC
TTCCACTCCATTCTGGTGTTTTTCTATAAGAAAGACAAGA
ATCACCTCTACAGAACATATGATGCATTCTCCACCTTCTA
CATTGGAGCTGATGGACGAATACATTGCCATAAAGTTGAA
AAGGTAATGGAGGCTCGTCCACCTCTGCTGCCCAAAGTGG
CCTCAATGCTTGGCGGGGCTCTGGTGGCCCTGGGCATTCA
GGAACACCGTCCCGCCCTCAACCTGCTCCCACTCCTGCTG
TCCTCCCTCCGACAGGCCCGAGCCTGAGCCGAGAACCTGC
GCTGATTGGTCACACCATTAAAAAGACTGTAAAAGATGTG
GCGCTCTATTATGTGGGTTGAGTAAATAAGATGTTGATAA
CCAATTCCTTGGGGGAAAAAAAGATTGCAGAAGTAAGCCG
GAACGAGTTAAAACTGATCTCACTTGAAACAATCTTCTAA
TTTCCATGATATGAATATCACCAACCCGATATCATATTTG
GTTTGGATTGTGATGGGAGCCTGTATTTAAGATTAAACTC
CACT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-215a10.4-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000018439 (1),  Ensembl_Trans:ENSDART00000073704 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CK027317 (1) 710 bp
GenBank:BG302703 (1) 617 bp
GenBank:BF158404 (1) 611 bp
GenBank:BF156446 (1) 589 bp
GenBank:AW454810 (1) 580 bp
GenBank:AI722255 (1) 544 bp
GenBank:CB359194 (1) 488 bp
GenBank:BG305009 (1) 373 bp
GenBank:BM280212 (1) 342 bp
CITATIONS (2)