Transcript

edn2-201

ID
ZDB-TSCRIPT-090929-3986
Name
edn2-201
Previous Names
  • edn2-001
  • si:ch211-202b2.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000018019 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000018019|OTTDARG00000015055|ZDB-GENE-060503-774 edn2|OTTDARP00000015218 edn2-001 LG_ AL954687.17 Danio rerio protein_coding KNOWN, 1775 bp
GAACACAAGCACCTGTCAGTCTCTCACTGTAGACACTAAC
TGTACAGCATCACTCAACTGGATTTAACAGGCGTGTGAAA
CTCTACAATGGCTTTTACCCTTCAGACTGCCCTTTTGGTC
TTAGCTACCCTATGTGTCCTGCAGCAAGGGTTTGGATATC
CACTGTCTAAACAACCTGAAGCATCTAGCAATCCACCTGC
TCACAAACGGGTCCGCACCAAACGCTGTTCCTGTAGTAGC
TGGTTAGATAATGAGTGCATCTATTTCTGCCACTTGGACA
TCATCTGGGTCAACACACCAAATAAGATCACCCCGCTTGG
TCTTGGGAGTCCTCTGTCCCGTCGCCGGCGTTCCACTGGT
AGATGTGAATGTGCGAATCCCGCCGATCGTACCTGCTCCA
GTTTCTGTCACACCAGTTCTGAAGATCCAGATATGGAGTT
TGTGACTCAACTTGATAACCAGTCAGATCACAAGGACAAA
ACTAGTGATCATCTGCTGTTGTCGCTCAGGAGGGTGGTAA
AACACAACCTCATGACAGCTTCACGTTTTGCTTCACCCAA
GAAGAAATCCAGGATCAGCTAGAGAGAGCAAAAGAGAAAG
AAGAGAAATGACTGTAGAAGTGAGCTTCTGAACAAAATCA
ATCCTGGATGAAGAGGATCTGCCTCTTGAGAGGTGGACAA
AAGCATGGCGGATTCTCAGACATCAAGATGAACTGAACCA
CTGAGGCACAAACCTTCAGATACTTCAGTTGAGCTGGAGC
CGAAACCACTGTTCGCTAAAGTGCAAAGATGATTTATATG
GTGAATAGAAGAACAGTTCCTCTTCCACACCAGTGAAATG
GTGGCATATGCCAGATGAGTGAGTTAACATTTAGCACAGA
AAGGCTTCCTGAAAGCCTAATCTCTTTTTTTGACACCAAA
TGTTCAGTAAAACATTATTTTTGTGTTCTTGTTACACATT
ATTTATGCATAATTAGATGAAATAACCTCAAATCAAGTCA
TTACCCAGTATACATTGTTAGTTAATATTAGTACTTAAAT
TACTGTAAACTGTAACAAGGGCACAGAAAAAAAACACACG
TTATTAAAGTTTTCCTCTGTATCAGAGATAAATACTGTTA
TTTATTTGTTTATTTATTTATTTATTGATATATATGTATT
TATTTATTTTACTTTTATTTGGAGTTTAGTTTTATCATTT
CTGCGATCAGATTTGTATTTATACAAAATGAAAAATGCAA
GATGTAGCCATGAGGAATGTTTATGTGTTTTCTTTTTTAT
GACTCCTTCTTTCCTCCATGTTTTCCCCTCATTTTCCCTT
GAGTGAAGGCGGAAGTATTTATTGCATACTTCCAATAGGC
TGTTTTTTTATTGTTCAGATACCAGCAAGTTTCAATAGCT
CAAAGCTTGCCAAAAAATGCTGTTATTGTTTTTCTAAAAG
TACAAACCGGCTGTTACTGTCTGGTCACTCATTATGTAAA
AGACTGTAGTGCTACTGAATTCCCTTTCCATATTAAATGG
AATATATTTAAATGTATGCTTATTTTACATACTATTGACT
ACTGAAGTTTGACTACTGCAAAATATATGTTAATATGCTG
CACATGTTCATGTTTTCTAGAAGAAGAAAAAGAAAACTAC
TTCACAGATACTTGAATGTTCAAATGTTAAAAATGCTTGC
ATCCATTTTGTTGTTGTTGTCTATTTAATTTATTTAATGA
AATCTATTTTTGTATTGCTGTATCTTTTAATAAACAAATA
TATACTTTCAAATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations