Transcript

ube2na-201

ID
ZDB-TSCRIPT-090929-3855
Name
ube2na-201
Previous Names
  • ube2n-001
  • ube2na-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000017655 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000017655|OTTDARG00000014764|ZDB-GENE-040426-2873 ube2na|OTTDARP00000014927 ube2n-001 LG_ CR753897.9 Danio rerio protein_coding KNOWN, 1795 bp
ACGCACCGCGCCGGAAGGCGTGTGTCTGTGCACTGCGTCT
CCGCCGTCAATGCAAACGAAGTAAGAGGCACCGTGAGTCA
AAGCTAAAATCCGCATTCAAGACAAGATGGCAGGGTTGCC
CCGCAGGATCATTAAGGAAACACAGCGTTTGTTGGCAGAG
CCGGTGCCGGGTATAAAGGCAGAGCCAGATGAGGGCAACG
CTCGCTACTTCCATGTGGTCATCGCCGGACCTCAAGACTC
TCCCTTTGAGGGAGGAACTTTTAAACTTGAACTCTTTCTT
CCTGAAGAATATCCCATGGCAGCTCCGAAAGTACGCTTCA
TGACCAAAATATATCACCCCAATGTAGACAAGCTGGGAAG
AATATGTCTAGATATTTTGAAAGATAAGTGGTCTCCAGCT
CTGCAGATCCGCACAGTGCTGCTATCAATCCAGGCATTAC
TAAGCGCTCCCAACCCAGACGATCCTCTAGCAAACGATGT
CGCAGAGCAGTGGAAGACTAATGAAGCTCAAGCCATAGAG
ACAGCCCGAACATGGACCAGGCTTTATGCCGGGAACAATA
TTGAAGTCTAGAAATGGGGGGAATGAAAAGAGAGAGAGAG
AAAAAAGGAAGTCAAGAGTGAACACAACTCCATGTTCTGC
CAAGACCTAATCATTTTCATGTAAAGGACACAGTCTTAGG
AAACAAACAAGCAAAATATGATAAACTGTAAGGAATATAT
TAACACAAGTAAAAAAAAAGAAAACTTCAGACAATTTGTA
ATTTAAATGCACATTAGTACAACAAAAAACAAGCGTCTTT
GTCCTGATTCACTGCTGTTCAGATGCATGGGCGGATGATC
TACTCATACGGCATTCTTTTACCATGGTTGGGGAGGGAGC
CGCAGACTTCTGCTATTAAGCGTGCATTAAAACTGACCGT
CATTTTTCTGTCCCATAGTTATTTTCTGGGGGGAGGGCTG
GGGTAACCTTTTTTTTATATTTCTTTTAACCTTTTTCTTG
TCATTGCTCTTTATTATTAAGGAGCTGCAGACTTAGCCCC
TGCTTAGAGCACCCTTTCTGTCAGACATCAGACTTACCCT
CGTAGAAAACATAGCAGAGAGCTCACTAAAATGGAAAAGA
AATCCAACATTTAAACCACATGCAAACAGTAGTTTCACCT
GGGAAATGGTTCAACTGGAAAGTCTTTCCACCATCACGGT
AACCGTTAAAAGATGTAAACCCTAACCTAGAACTTGATTT
ATATTTGAACTATGGATGGGCAAAGTAGAGCTAGAGAGAG
AAGGGAGATGTTGCGTAATATTTCTTTTAGTATAACAATT
CTGTCATCGTATCCGGTTTTAGTGTTTTGTTTTTATCTAT
CTTGCCATGGCTGTTCTAATTGCACTCTTGAAACTCCATC
ATTGCGTGCTTTTTTTCTTTTTCTTTTCTTTTTTCTCGTG
TCCAGCACAGTCCACTGCATTTAGATTCATTTGTCTGTTT
CTTCCCTTAAGCATTTATTTCCTTGCGCCAAGGTAGCTGG
GGCGGGGGGCTGAAGACGAATGATGGATAGTGAGATTTTT
AGTAAAGGGATTGAGGGGTGGGAATGTTTGCGGAAACATT
GTAAAAGATCAATAAAGGCTTTGTCTCAATTTCCACGATT
GGTCTTTGGTTAAAACGTCAAGTCTGTAAATTCCCGCTTT
CTATAGAAAGGGGAAAAAAAAATAAAACAAATTCTGCTTT
TTAAAAATGTGATGACAAAAGTCCACACACATATTTCTGT
TCTTTCTGTAAATAAAAATCTGTTGATTAATAATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations