Transcript

sall3b-201

ID
ZDB-TSCRIPT-090929-3800
Name
sall3b-201
Previous Names
  • sall3b-001
  • sallb-001
  • si:dkey-195c14.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000017492 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000017492|OTTDARG00000014635|ZDB-GENE-030131-9140 sall3b|OTTDARP00000014810 DKEY-195C14.1-001 LG_ BX890563.6 Danio rerio protein_coding KNOWN, 6395 bp
CGAATCTTTTATATAGGCTAAAACAACTCGTCATTCACAT
AAACAATTGTTCATAAACGTAAAGGCGACATCGTTTGCGG
GAGGGCTATGGTTAAACTGGAGGCATATGCTTAAAGTAGA
TCAATACACTTGTAAAGAGCCTGTTTGAGAGGTGCTTGAA
TGTTATTCACACTGTCATTTATTTGAAAAGAAGGCGTGCG
AGCGTGACAAGACTGGTTTTCCGTACTTACGGTGATGTTT
AACAAACTACGGATGGACTTTACGCCGTGTGAAGTGCCAC
CAGAGCTGTAGACGCACTTGTTTGCGTCCAGTTTGTGGTC
CTACGTGAACAGAGAGCAAAAGGGGGAAAAGTGAGGAAGT
GAAACGGGCTAATTACTCAGTCCATCCCTCATTTCCATAT
CCAGAGAGAGTGTCTACTGGCGCGCGGCCAATCCCTCATG
CAGCGCAACGTAATACATGACCCTCTATCATTATAACGCC
GACATGCGCAATCTGCACAACGGTAACAACATCTAATATC
TCTTATTCACTGACCCTGGGACTGTACGGGACTGCCTGCG
TCCGATGTTTCTGCAGATCGGAGCGCCGACGCGAAGCGCA
GAGACATGTCCCGAAGAAAGCAGGCGAAACCTCAGCATCT
CCGATCGGACGAAGAAGGAACACAGTCGGACAAAAGTCCG
GATAACGCACTTCTGTTGAGGGGAGGCGATGAGGAGGACA
GCGGCACGGAGAGCCGCAGTGGGGGCGAAGAGACGCACGT
GTGTGAGCGGTGCTGTGCTGAATTCTTCAAGTGGTCTGAG
ATGCTGGAGCACCAGCAGAAGTGCACAGAAGACCCCCCTG
TGCTCATAGTAAAAGAGAAGGAAGAGAAGGTCATTTCCCG
GGGATCACCGACAGAGTCCCTCTTTAGCGCCCAGAGTGAC
TCAGCAGAAATGGAGGCCAGTGAAATCAACTCCGAGCTTG
CGGAGAAAGTCGACGAAATGCCTGAGGAAACCCATATTAT
TGACCTGGACGAACAAATGGATATAAGTTTGCCTGAGCAT
AAAACATCGAATCTCAGCCCTCTACCACTAGACGATGAAA
ATGCCACCTCGCCCCCCGCCCCACCTATAACCAATCACTA
TGACATGCCCAGCACCAATGTGACCCTGGAGATTCTTCAC
AGCACTCGAGTGGCTGTTGCTCAGTTTTCCCAGAGCATTC
ACTGTGCAGGATCTGCTGGAAAGCTGAACTCTGCTGCGAT
ACCCATGATTTTGGAGCAGTTGATGGCACTGCAGCAACAG
CAGGTTCAGCAATTACAGCTCATTGAGCAGATCCGCAGCC
AGGTCGCTGTAATGAATAGGCAGCCTACGCAAGCCGCCCT
TAATCCTGCCTCGAAAAGCCTACCCTCTGACTCTAACACT
TACAATTTCCAGGGCATCGCTCCACCCCCTGTACTCCCAT
TATCTGGGGTCATGCCCTCTACAGTGAATGGGCAGGCCTC
TGTATCCCAGGCATCTATGCTTGCGAGGCCATCATTGCTG
TCTTCCCAACCAAGCACTGGGCAAATTGGCTCTAGAGCAC
TGGACAGTGCAACTTCTTCCTTGACAAGTTCCAGCCCTCA
TCTCTTCAGCTACAGTGGGGCTTCTCCGCTCTTGCCCACC
TGTAGTGGATCCCTCTCTAATGTTAGTAACACCCAATCTG
TAAGCACTCCCAGCCCACTATCAGCTTGCCAGAGTAGCCT
CCTTAGCCCTTCTGCCAACCTACCATTACTACCTCAAAGC
CCTCCCAACGGAGTCATATTTCCCAATCCACTGGCCAGTA
TTGCAGCCACTGCCAGTGCACTAGACCCACTGGCTGCTAT
GATGAAGCACCGCAAGGGCAAACTGCCCAGTGTCTCCATA
TTTGACAGCAAGCCTAGTTCTGAGGATCCGTTCTTTAAGC
ACAAGTGTAGGTTCTGCGCTAAAGTGTTCGGCAGCGACAG
TGCCTTGCAGATACACTTGCGCTCGCACACAGGCGAGAGG
CCATTCAAATGCAACATTTGTGGCAACCGTTTCTCAACAA
AAGGAAATCTCAAAGTCCACTTCCAAAGGCACAAGGAGAA
GTACCCTCATGTTCAGATGAACCCGTACCCAGTCCCAGAA
TATCTTGACAATATCCCCACTAGCTCTGGGATCCCCTATG
GGATGTCTTTCCCCCCAGAGAAGGCTGGACCTACTTGGTT
AGACAGCAAACCTGTCCTTCCAACAGTGCCGTCTTCGGTT
GGTCTGCAGTTGCCTCCCACAGTACCAATTATTGAAAGCC
TAAGTGATTCATTTACAAGCACACCCTCAGAAAGGTCTCC
ACACAGGCCATCACCAGCAAGAGGTGAACTTGCACCGTCG
TCGCCAAATCCCACTGGCACTGAGACAGATGTGTCAACCA
TTGCAGCCTCCCCTAAATCAAACAGAGAGGCAGAGATCAC
ACAGAGTTTCAATACAGAGGAAGTGCACCTACCGTCAAAC
AGTTTAATCAGAAATGGTAGCAATTCCAACATCCTGCTTT
CGCAGTCCATGTTGACAGAAACACCTGTAAAAGGGAATGT
ACCCGAGTCCACTGATGTTCCTTCAGCCATTATTAAACCG
TCCTCTCCACCACTCATCTCAGATCAGTTCAGGAGCAAGT
TCCCATTTGGTGGTCTCCAGGATTCTATGCAAACATCTGA
GACATCGAAGCTCCAACAGCTTGTGGAAAACATTGACAAA
AAGATGATGGAGCCCAATCAGTGTGTGATCTGCCACCGTG
TGCTAAGCTGTCAGAGTGCGCTGAAGATGCATTACCGCAT
CCATACAGGAGAGAGGCCATTTAAATGCAAGGTTTGTGGG
AGAGCATTCACAACAAAAGGTAACTTGAAGACTCATTTTG
GTGTCCACCGTGCAAAGCCTCCTCTTCGGATTCAGCATTC
ATGCCCGATCTGTCAGAAAAAGTTTACAAATGCTGTTGTA
TTACAGCAGCACATACGCATGCACATGGGTGGGCAAATTC
CAAACACACCACTGGCAGAAACCATCTACGAGAAAGACAC
AGATATGGAGAGTTTTGACAGCATGAGCACTTATGACGAC
GACTGTCTTGATGATATTTCATTTGAAGAAGAAGGGGATG
TTGTGGAGAACAGTGAAAACACCCTGAGCTCCTTTTCAGA
TAGTCCACCACCTATCTCATCTCTTCCATCCAGTATCTCA
GAATCTCAGAATGTAGGGGGCGACTTATCCATCAATCTCA
GTCAATCAAATGGAAAAAAGATGGTTAGGTGCGACCCTAT
GGACAATGATCTTCATGCTCCTCATACGTCCACTGGTGAG
ATGGAAAACCACAGCATGGGAAATAGTTTAATGCCACATT
CATCTAGCTCTATTCACATTCCAACCTATTCCAACAGTCA
ACCTGAGGGACAGCATGAGCATTCGGTCTCTCTGAACCTC
TCTTCTAAAACCCCAGAGGCAGCAGCTATAGTAAAATCTG
AATCAACAGACTGTCCTGCAGCAAATGCAGTCAACGGGGT
GACTCTTAATCAAACAGGAATCCAGCCTATCAAGTCTTCA
GTAAAGAAAGAAAACCCTTTCAACGTGCAATGTTTCAGTA
AGGAACATGAAAATGTTCAAAGGTCTACTGAACAGGATAC
TAAAAATCTGCCAACTGCAGTGAAACTGGAGATGAGCATT
TGCAGTAGACCATACATGCTAAAAGAAGGTCCTTTCCCTG
CATTTGGCCTGCAGTCTCCCACCTCACGCTCTGAGGTGAT
GATACCGGGCGTCACCTCACTCACTGGACCACCTCCACCA
CGACGGACCCCTAAGCAACACAACTGCAGCGCATGCGGAA
AGAACTTCTCTTCTGCCAGTGCTTTGCAGATCCATGAGCG
CACACACACTGGCGAAAAACCCTTCGGCTGCTCTGTCTGT
GGTCGAGCATTCACAACCAAGGGTAATCTTAAGGTGCATA
TGGGCACTCACATGTGGAATAACACTCCTGCCCGTAGAGG
TAGACGTCTGTCTGTGGAAAACCCAATTGCCCTTCTGGGC
GGTGATGCCTTGAAATTCAGCGAAGCATTTCAGAAGGATT
TAGCCGCACGGGCCATGAATGTGGATCAGAACTTCTGGAG
CCGATACGCAGCAGCTATTACAAACGGCTTAGCAATGAGG
AACAATGAAATATCCGTCATTCAGAGTGGAGGAGTGCCCC
AGCTTCCTGCTATCACTGTGGCTACGGACAAGGCTAGCAC
TGGAAACAGCCCACCAATCACAGCCATGGAAAAAACAGGC
TTAGAAAGGGGACCCGGACAACACTTCTCCATGATGATCG
ATGATAAAAAAGACATTGGGATCAATTAATGTAAAGGTGA
CATATTCTTTTTCCTTCCATAAGGGACATTGGAAATAAAT
GTGTCTTGTTTTTTTTTTAATAAAAAAAATCAGAATAAAC
TCCTTAGAATGTGCTTGATTCATGTGGGAAATTTACGATT
TATCTTAAATATGGCACTTGTTTTTTTATTTTTATTTTAT
TGTATTTTAACTGAGGCCACGTTTAGTTTTTCAATTATGT
CAACTGACTGAAAACTTACACTTGATACAAGGGCATTGCT
TTGATATGAAATGATTATTTTATGTTGTAAATGTGTATTT
TATGTTGATTTGATTTGTTTTTACTCTCTCATTTTGTTGT
CAAACATTGCTTTGTTCAAGAGAACATGTTTGCATATACA
GTTGCAATCAGAATTGTTAAACCCCCTTTGATTTTTTTTA
TACTTTCTAAATGATGTTTAACAAAGCAAGGACATTTTAA
AAGTGTGTCTGATAATTTTTTTTCTTCTGGAAAAAGTCTT
ATTTGTTTTTATTTCGGCTAGAATAAAAGCAGTTTTTATA
AAAAAATCATTTTAAGGTCAAAATTATTAGCCCCTTTAAG
CTATATTTTTTTTCTCGATAGACTACAGAACAAACTATCG
ATATACAATAACTTGCCTAATTACCCTAACCTGATTAGTT
AACCTAATTAACCTAGTTAAGCTTTTAAATGTCACTTTAA
GCTGTATAGAAGTATCTTGAAAAATATCTAGTAAAATATT
TACTGTCATCATGGCAAAGATAAAATAAATCAGTTATTAG
ACATGGGTTATTAAAACTATTATCATTAGAAATGTGTTGA
AAAATATCTTCTCTCCGTTAAACAAAAATTGGGGAAAAAA
ATAAACGACGGGATAATAATTTAGGGGGTTTAATAATTCT
GATTGCAACCGTATAATAGAAACTTTTTCATTCCCACACT
GTAGTCTTAACGTAGCTACAGAGGAAAGTATGTAACTTAA
ATCCCCAAGCAGAAGATTAAGAGACATTTCAGAGTTTTTT
TAAAGAGATGTATTATTCTTTGACATCCCACTGCTGTGCT
GCTATGCATCGGATGCAAACCATTTATTTTCATGCAAATC
AAGAACACCACAATCTAGTATTATTTTAGCTGCCATTAAC
AATGAAACGTTCCACCAGCCTATGATATTATATTATTAAT
TCCCATGATGTGTATTTTCCTTAACATCTGAAGTTGATTA
GTGGGCCAACATGAGACTAAGAAGAATAATATGAGTGCTA
ATAAAGGTCTTGCATTTAAAACACATTCAGTTTAAATTAT
AGTTGACAATGGAAACCCTTGTGATGGATCGGACATGTTG
CGAAACATTTCTATTTCACAATTTAGAAGTGTGTTTTCCT
GTCAAGAACAAAATACAAGTAAAATGATATATTATTCCAG
AAACATTATAGTACAAGGGAAAAAAATGAATAAAATAAAA
CTATGTACTTGTCTGTAATGCTAGCTTATGTCTTTTTTAC
TAAGCGTGTCATGTCAGGTAATTTTAGTGTTTTTTTATTA
TTATTATTTTATTATATTTTATTTTGTAGTGCTATTTTCC
TTATATAATATATTGTTTAGTGTTGGGAAAAACAAACAAA
ATTATGAAAAAGAATTTTTTTTTTCAAATGGTATTTGGTA
AAATAAGGAAGGGGTATTTGATGTATTCTCTGCATGAAAG
GGAGACACTATTTTTGTACTCAGATACATTATAACGAATA
AAAAGGTACGCCGGGTTTGCTTTTCTGTCTCTGCACATCA
GTATTTTTACATGGAACAACTGAGGTGGTCTCTCAAACAC
ACTGACTAAACTGGATTTATTTCTATGATGCAATATTGTT
GCCACCCTCAATAAATAAATCTTAAACGACGTATTTTGTG
TCATTACTATTGTAGGTACAGCCTTCAGTCTATTTCTGTG
TGTATGTTGTACATATATTTATTAATAAAAAGTTGTCAAA
CGGTATTGTTTAAATGATTTCGTTTGGAAGTACAAGCCTA
GAAAGAGCAACTGAGGTTAAGTTTTATCTTCGCAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations