Transcript

cpsf6-203

ID
ZDB-TSCRIPT-090929-3724
Name
cpsf6-203
Previous Names
  • cpsf6-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000017333 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000017333|OTTDARG00000014511|ZDB-GENE-030131-5277 cpsf6|OTTDARP00000014684 cpsf6-002 LG_ CR749743.13 Danio rerio protein_coding KNOWN, 813 bp
GTGACGGCCATCTCTCTGATCAAGCAGTCGAAGGTTTCTG
CTGACGACCGCTGCAAAGTTCTCATCAGCTCACTGCAGGA
CTGCTTGCATGGAATCGAGTCCAAATCGTATGGCTCTGTG
GCAGGTGCCATGGCAGATTTAAATCAGGGACACAATGGAT
TTTACCGACGGGAGCGGTCCAGGGAGAGAGATCACAGTCG
CTCTCGTGAGAAGAGCCGCCGGCACAAATCTCGCAGTCGA
GACCGGCATGAGGATTACTACCGGGAGCGCAGCCGAGAGA
GAGACCGCCATCGTGAGCGAGACAGAGACCGCGAGAGAGA
CAGAGAACGCGAGAGGGAATATCGCCACCGTTAATAGGAG
AAGAAGCTGAACGCAAGAGGAGGAGGAGGAGACGCCAGGA
GCAACGAGGATTCATCGCGCACACACAAACACCGTCACGG
AGAGCGCCGGACTCCGGACACACTAAAAAAAGTAGAGTTC
TGTACAATACTATATACTCACTCTCTTAATTCCCTGCAGC
TCTTTTTATTTTGTACTTTTATTTGGAAGTAGCTGTGTGC
TTAAGTCAGTTCAGCTTGTTTTGGCCAAGGAAGTGAATTA
TTTGCCTGCTCGTTCAAAAAAAGAAAAAAATACACACACA
CAACTTTCCGACTGCTATAATGTTGTAAATTGTCAGTTAG
CTAGATTTGTTTTTATAGGATCCTTTCTTTCGTTTCGTGT
TTCTTCCCTCATTTCCCCCCCTTCCCATTATCCATATAAT
GTTTGTAAGTGTCTTTTGGCTTGATTATTAAATAGAATCT
GTGTTGTAATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations