Transcript

snd1-201

ID
ZDB-TSCRIPT-090929-3668
Name
snd1-201
Previous Names
  • snd1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000017154 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000017154|OTTDARG00000014367|ZDB-GENE-030131-3124 snd1|OTTDARP00000014530 snd1-001 LG_none BX890545.7,CR931778.23,BX855622.6,BX897731.7 Danio rerio protein_coding KNOWN, 3759 bp
TTCACGCGCTGTGCTTCCGGTTAAGCAAAGCGTGATCAGT
CGTGCTCAGTCTCTCTTCCCTTCCTCGGCTCTCAGTAGAG
ACGTCTCGTAGGACTCTCCCGGCTCCTTTACCTCTCTCTC
TCTTTTCCCTCCCTAACGGAATACTCATTCATCCCAGCGG
CCATGGCATCTGCGGTACCGGCACAAGTTCAGTCCAGCCA
AGCGTCAGCCCCGCAGCTGCAGAGGGGAATAGTGAAGATG
GTGTTATCGGGTTGTGCTATCATTGTTCGAGGTCAGCCAC
GAGGTGGACCTCCTCCAGAACGACAGATCAACCTGAGTAA
CATAAGAGCCGGAGCTCTAGCCCGTCGTGCAATTCAGGGT
CAGCCAGACACCAAGGACACACCAGATGAGCCATGGGCTT
TCCAGGCACGAGAGTTTATGCGCAAGAAGGTAATCGGCAA
AGAAGTCTGCTTCACTGTGGAGAATAAAACTCCTCAAGGC
AGAGAATATGGCATGGTTTACCTGGGAAAAGACACATCAG
GAGAAAATATTGCCGAATCCCTGGTGGCTGAGGGTCTTGC
TATGGTTCGCAGAGAAGGCATCAGAGGAAACAATCCTGAG
CAGGTCAGACTGTGTGATTTGGAGGATCAAGCCAAGTCTT
CTAAAAAGGGCCTGTGGTCTGAGGGTGGAGGCTCGCACAC
CATTCGAGATCTCAAGTACACCATCGAGAACCCTCGCAAC
TTCGTGGACTCCCTGCATCAGAAACCAGTCAACGCTATTA
TCGAGCATGTGCGCGATGGCTGCATGGTTCGAGCACTACT
TCTGCCCGACTACTATCTGGTGACAGTCATGCTGTCTGGA
ATCAAGAGCCCTACGTTTAAGCGGGAGGCAGATGGCAGCG
AGACCCCTGAGCCCTTCGCAGCAGAGGCAAAGTTCTTCAC
CGAGTCTCGACTTCTTCAGCGAGATGTGCAGATCATTTTG
GAGTCCTGTCCAAACCAGGTCATTCTGGGAACCATCTTGC
ATCCGAACGGAAACATCACGGAGCTGCTGCTGAAGGAGGG
CTTTGCTCGCTGTGTTGACTGGTCCATGGCTGTTTACACT
CAGGGTGCAGAGAAGCTCAGAGCAGCAGAGCGATCAGCAA
AAGAGCGTAAAGTGAGAATTTGGAAGGACTATGTTGCTCC
CACAGCCAATCTGGACCAGAAGGACAGACAGTTTGTTGCA
AAGGTGATGCAGGTCGTGAACGCAGATGCCATCGTGGTGA
AGCTGAACTCTGGGGAATATAAGACCATCCACCTGTCCAG
CATCAGACCCCCGAGGCTCGAAGGCGAGGAGAAGAACAAG
GACAAGGACAAGCGTTTCCGTCCACTCTATGACATTCCTT
ACATGTTTGAGGCACGCGAATTCTTGAGGAAGAAGCTCAT
TGGCAAGAAGGTTAATGTCACAGTTGATTACATCAGAGCT
GCCACCAATGCCATGGAAATGGGCGTCCCGGCTTTCCCAG
AGCGCACCTGTGCTACAGTCACCATTGGAGGAATAAACAT
CGCCGAGGCACTGGTCAGCAAAGGTCTTGCCACAGTGATC
AGATACCGCCAAGATGACGATCAAAGATCTTCTCATTACG
ACGAGCTCCTGGCAGCAGAGGCGAGGGCGATCAAGAATGG
CAAAGGACTTCACAGCAAGAAAGAAGTGCCCATTCATAGA
GTGGCGGACATTTCAGGGGAGACACAGAAGGCGAAACAGT
TTTTCCCATTCCTGCAGAGAGCGGGCCGCTCGGAGGCTGT
GGTGGAGTACGTGTTCAGTGGCTCCAGACTCAAGCTCTAC
ATGCCCAAAGAGACGTGTCTCATCACCTTCTTGCTCGCTG
GAATCGAGTGTCCCCGAGGGTCTCGTAACATGCCAGGTGG
GATGCAGGTGGCAGAGCCATACAGTGAAGAAGCTATGCTG
TTCACCAAAGAACTGGTTCTTCAGAGAGAGGTGGAAGTGG
AAGTGGAGAGCATGGATAAAGCAGGGAACTTCATTGGCTG
GCTTCACATTGAGGGCGTGAATCTGTCTGTGGCTCTGGTG
GAAAATGCCCTATCTAAGGTTCACTTCACTGCAGAGAGAA
GCTCCTACTACAAGACTCTGGTGTCTGCAGAGGAAAGCGC
AAGACAGAGGAAAGAGAAGCTTTGGGCCAATTATGAAGAG
AAACCAAAAGAAGAGGTGGCTCAGGTCACAGAGGCGAAAG
AACGTGTGGCGAAATACAGATCCGTCTACGTCACTGAGAT
CACAGATGGACTGCACTTCTATGCGCAGGATGTGGAAACC
GGTACTAAGCTGGAGAACCTGATGGAGAGCATGCGAGGAG
AGATTGCAGCCCAGCCTCCAGTGGAAGGATCCTTTGCTCC
ACGCAGAGGGGAGTTCTGCATCGCAAAGTTTGCTGACGGA
GAATGGTACAGAGCTCGTGTTGAGAAAGTGGAATCTCCAG
CAAAGGTTCACGTGTTCTACATCGACTATGGAAACAGAGA
GGTTTTATCCTCCACGCGTCTCGCAGCTCTTCCTCCAGCC
TTCAGCACGCGTACACTTCCTCCACAGGCTACAGAGTACG
CGTTTGCCTACATTCAGGTCCCGCAGGATGAAGACGCTCG
TGCCGATGCCGTGGACAGTGTGGTGAGGGACATCCACAAC
ACACAGTGTCTGCTGAATGTGGAGTACAGCGGCAGCGTCT
GTCCGCAGGTCACGCTCCAGTTCGCAGACACTAAAGAAGA
TGTGGGTCTGGGTCTGGTCAAAGAAGGCATGGTCATGGTG
GACATCCGGAAAGAGAAGTACCTCCAGAAAATGGTGACTG
AATATCTGAATGCCCAGGAATCTGCCAAGAGCGCCAGGCT
CAACATTTGGCGTTATGGAGATTTCCGTGACGATGATGCG
GACGAGTTCGGTTATCGACGCTAAGTTGTTGCTCCAAAGA
CCTTGTGGAAGACCAGATGCATTTGCAGAGAACACAAAAC
ACAAAAAATCATGAAAAAACAAACTCAACAAAACATCAGT
ATGCTTTTATTTGTTTTGTTTTTCCTATGTTGAACATTTG
CCTCTCTCCGTTGTTTTTTTTTTTTATATATACTCTGTGC
ATATCCTCTCTTCTGCCCAAGGACTTTCAGTTTCTAATTT
TTTTTAAAGCAAGTACGCTACAGATAAATCTACCTGTCGC
TGCTTCTAATAGGACCAACGTATTTACCTTAATTTTACGT
TTTGACATGATAGCCAATCACGTTTTTTCTTTTTTTCGTC
ATGTAAATTTTTTTAGCCAATCACCAGCTGTCAAACCCCG
TCTTAGCGAACCTGATCAGCTCAGTCAGATGTCTATGTTT
TGGGGCAAGACTTTTAAAGAAATGAGGGGAATGATGCACA
GAGCAACCATGAGCTTATCGAGAAAACGCCTCCTTAATCA
TGAGATTCTATATTTCAATACGTATATATATATGGATATT
TTGAAGTTAGATCAAAACTAACCAAGTGAACTTACTTGAG
CGTATTTCCGTCTCTCTCTCTCTCTGATGTGATCTGAGTG
TTCAGTGACATTTCTGGGCATTTGTGTAGGACGTGTGTTT
TCTCTTTTCATGTGACAAAAGAAGCACCTTTTCCAGGCGT
CTCTGGGCTTCCTGTGAGGTTTACTCTACGCTCAGCGTTT
CTTCTTCTCCCGCTCTTGCCCGCCATACAGAAACAGTGTT
TGAATTTGTTTCCTCCTGAGGTAGACCCTGTCATTGTATT
TAAAGCTGATAAATAAAAAAAAATGAGCAAAGTGAAACG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations