Transcript

v2rx1-201

ID
ZDB-TSCRIPT-090929-3469
Name
v2rx1-201
Previous Names
  • v2rx1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000016536 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000016536|OTTDARG00000013891|ZDB-GENE-050419-175 v2rx1|OTTDARP00000014036 DKEY-183J10.1-001 LG_none BX908736.10,BX901875.9 Danio rerio protein_coding NOVEL, 2607 bp
ATGCCAGTGATTGAACTGGTGTCACTGGGCCTTGCTCTTC
TGTTGAACTTCTCAGTAGTTTTATGCACCTCATTGGACAA
AAGTTGCTGGACATTGGGTGATTTTAATTCCCCAGTACTG
GAACAGGATGGTGATATTGTAATTGGAGGGCTGTTTCCCA
TGCACAATATAGCTCCAGAAACTGACTATAATTTCTCTGA
TTTGCCACACTATCAAGATTGTAGCAGGTTTGACTTTCGT
GCATTTCGCTGGGTTCAAACAATGGTCTTTGCCATTGAAG
AAATCAACAGCAACTCAAGTTTGTTACCTGGAGTGGCACT
AGGTTATAGGATCTTGGATAGCTGTGATCATGTGCACACC
AGTCTGCGCAGTGCACTTTTTCTTCTGAACGGCACATTTG
GTCAAACACAGACTGATGCTGTTGGCACTGCAAATTGCCT
GTCCACAGCCCCAGTGCCAGCTGTCATAGGCCTGGCATCA
TCTTCACCTACACGAGCTGTGGCACAAACTTTGGGTCCGT
TTGGAATTCCATTGATAAGTTACTTTGCCACATGCACTTG
CCTCACAGATAAAAAGGAGTATCCTTCTTTCCTTCGCACT
GTCCCTAGTGACAGGTTTCAGGTGCAGGGACTGGTCCAGT
TGGTTTCCCACTTTGGTTGGCGCTGGGTGGGTACAGTGGG
CACGGATGATGACTACAGTCACTATGGTATCCAGGCATTT
ACCGAGCAGCTTGAAAGACTTGGTAGCTGTATTGCCTTTC
ATCAAACTATACCCAAATCACCTTCTCAGGCACAGATACG
TTCTATTCTTAATAGTCTTGAAAGTTCTACAGCACAAGTA
ATTATAGCATTTGCCACTGAAGGAGAACTGCTGGAGCTCC
TGGTTGAAGTTGCTCGCCGGAATCTGACTAGGTTGCAATG
GGTGGCCAGTGAGGCCTGGGTGACAGCCAAACTTCTCACA
ATCCCCGAGCTTCATCCTGTCCTGATAGGAACAGTGGGCT
TTTCTTTCAGGGGCACCGCTATTCCTGGCTTGGCTGAGTT
TCTCTTCAGGGTAAGGCCTTCATCGAGACCTGAATCTGCT
TTCACTAACATGTTTTGGGAGGAACTGTTTGGATGCAGAC
TAGGTTACGAGGACAGCAATGATTCTGTGTTGCCACTCTG
TACTGGCTCAGAGAATCTGCTGGAGACGGAAAGTAGCTAC
ACTGATGTATCAAGGGTGAGGATTTCATACAATGTCTATA
AGGCTGTCTATGCTATAGCTCATGCTCTACACCAGCTATT
ACAATGTGGCTCTAAGGAACAAGGCTCAGATCACAGCTGT
AATACTGAATCAAAGTTCTCTCCATTGCAGCTTCTACGCT
ATCTGAAGAAGGTACACTTTACAAACCAGTTCAATGAAAA
AGTCTATTTTGACACCAATGGAGAGCCTGTGCCACTCTAT
GACATCATAAACTGGCAGAAAAATGCTAGAGGTACCATCA
ATTTTCAGTTGGTTGGCACCTATGACGGCTCCGCCCCACA
TGGGCAGCAGCTTAAAATAGAAGAGGGCTTAATTCGGTGG
ACAGGCGGACAAACCAAGGTTCCAGTTTCCTTATGCAGTC
CTCCTTGCCCACCTGGAACCCGCCAGGCCACTCGACCAGG
ACAGCCTGTCTGCTGCTTTGACTGTTTGCCTTGTGCTGAA
GGAGAAATCAGCAATATATCAGGTGCTACTGAGTGTCTCA
AGTGTCCAGAGTACTACTGGCCAAACAAAGAAAGAGTTTC
CTGTGTTGCTGGCATTGAGGAGTTTCTGTCATACCATGAC
GTGATGGGGATCATTCTCATTTCTTTGTCTCTATTTGGTG
TTGCTGTGGCAACAGTTGTTATGGTGATTTTTTTTATTTT
CCGAAGCACACCCATAGTTAAGGCCAACAACTCTGAGATG
AGTTTTCTACTGCTGCTGTCTCTCAAACTTTGCTTCCTTT
GCTCACTGGTGTTCGTGGGTCGACCCTCGCCATTGACATG
CCGCGCCCGACAAGCAGCATTTGGAATCAGCTTTGTTCTA
TGTATCTCATGCATACTGGTCAAGACCATAGTGGTGCTTT
TGGCCTTTCGTTCTACAGTTCCTGGATCCATTTCTCTAAA
GGTGTTTGGCCCCCCACAGCAAAGGGTTTTCATTTTCTGC
TGCACAACAGGACAAGTTATTCTGTGCGCTTGTTGGTTGG
CACTAGCACCTCCTTACCCCTATAAAAACACATCCTATCA
GGATGGCAGGATTATACTAGAATGCAAAGACATTTTGCCA
CTTGGGTTTTACCTGGTTCTGGGCTATATAGGATTGCTCT
CTTGTATGTGCTTTGTCCTCGCTTTCCTTGGAAGGAAACT
TCCAGATACATTTAATGAAGCTAAGCTTATCACATTTAGT
ATGCTCATATTTTGTGCAGTGTGGATCTCTTTTATACCAG
CATACAACAGTTCTCCAGGGAAATACACAGTTGCTGTTGA
GATATTTGCCATTCTAGCTTCTACTTTTGGACTTTTATTT
AGCATTTTTATACCTAAATGTTATGTAATTCTGTTAAGGC
CTGATTTAAACACCAAAAAGGGAATGACTGGAAAATTGTC
GAAATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations