Transcript

si:ch211-132b12.4-201

ID
ZDB-TSCRIPT-090929-3289
Name
si:ch211-132b12.4-201
Previous Names
  • si:ch211-132b12.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000016061 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000016061|OTTDARG00000013515|ZDB-GENE-050419-207 si:ch211-132b12.4|OTTDARP00000013630 CH211-132B12.4-001 LG_ BX664607.21 Danio rerio protein_coding NOVEL, 429 bp
TGGAAGCGAAGAAATTAACCCAATTCAAGGAGAAATAGAG
GAGCAATGGTTCAGAGGAAGCAAAGCAGAGTTTCTTCTGG
CTGTGGCAGGAAATGTGGTTGGAGTGGGCAACGTGTGGAG
GTTTTCCTTACCTCTGCTACAGGAATGGAGGATGGGCGTT
CCTGATACCCTATCTGATGTTTGTGGTGACCTGTGGGGTT
CCTCTGTTCCTGCTGGAGACAGCTATGGGACAGTTTACAC
AGCAAGGGGCCATTACATGCTGGCATCATCTCTGTCCACT
AGCTGGGCGTATTGGATATGCAGGACAGCTAAAAGTGGTG
TACGGCTGTATGTATTACATCATCATTCTGGCCTGGGCAC
TTTTCTACCTCATCTACTGCTTCAGCTCACAACTGCCATG
GGCCAGCTGTGACAACATCTGGAACACAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations