Transcript

foxf1-201

ID
ZDB-TSCRIPT-090929-3167
Name
foxf1-201
Previous Names
  • foxf1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000015723 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000015723|OTTDARG00000013245|ZDB-GENE-050419-153 foxf1|OTTDARP00000013349 DKEY-199I24.2-001 LG_ FO834814.1 Danio rerio protein_coding NOVEL, 1383 bp
GATAAGTAAAAGCCCAACTCCTAAAGGAAGGACAAGAAGA
CTGGATCTCGATAGGAAGCCGAATGAATCTTTTCCCTGCT
GTGTTCAGTTTTATGTTGAGTAGTGCTTAGACAGTAGGCC
AGTGTGAAATTACGTACAAAGAAAGAACTTAAAGCAGCGC
AGTCCGTTTCTAATGATAAAAGTTTAGAAACTTAAGTTTT
TTTTTCATCGTGGATTTTGACGTGCGCGTAAACGTGAAGA
ATGACGGCTGAAGTGCAGCAACCCTCTGTGCAGACCCCCG
CTCACAGTAGCCCCATGACGGAGAAACCCGTCCAGACGCC
TGTGATGGAGACCTCCTCTTCCTCCTCAAGCACGAAAGCA
AAAAAGACCAACGCTGGAATTCGTCGTCCCGAAAAGCCCC
CGTATTCTTACATCGCTCTTATTGTCATGGCCATCCAGAG
CTCTCCAACCAAACGACTCACTTTAAGCGAAATTTATCAG
TTCCTCCAGAGCCGCTTCCCATTTTTTAGAGGATCGTATC
AGGGCTGGAAAAACTCTGTGCGTCACAATCTGTCTCTGAA
TGAATGCTTCATCAAGCTACCCAAGGGTCTAGGCAGACCT
GGAAAGGGTCACTACTGGACCATCGACCCAGCCAGTGAGT
TCATGTTTGAGGAGGGATCCTTCCGCAGGAGGCCGCGGGG
ATTCAGACGCAAATGCCAGGCGCTCAAACCTTCCATGTAC
AGCATGATGAACGGGCTGGGATTCAATCACATACCCGAGT
CCTATAACTTTCAGGGGGGCGGCGGGGGCCTGTCTTGTCC
TCCAAACAGTTTATCTTTGGAGAGTGGAATTGGGATGATG
AATGGACATTTGGCTAGCAATATGGAAGGAATGGGCTTGG
CAGGACACTCTATGCCCCATCTATCAACGAATAGTGGACA
TTCCTATATGGGCAGTTGCACGGGATCATCAGGGACGGAG
TACCCCCACCACGACAGTTCCGCATCGCCGCTTCTCACCA
GCGGGGGGGTGATGGACCCGCATGCCGTGTATTCTAGCAC
GGCCTCGGCCTGGCCTTCAGCGCCCCCGACATCTCTAAAT
AACGGGACGTCCTACATTAAACAGCAACCGCTCTCTCCGT
GCAATCCCGGTGCCAGTTCATTGCAGCCCAGTTTACCAAC
ACACTCTTTGGAACAGTCCTATTTGCATCAGAACGGTCAC
GGTACCACCGACCTCCAAGGTATACCGCGCTATCATACCC
AATCTCCCAGCATGTGTGACAGGAAAGAATTTGTCTTTTC
TTTTAACGCCATGACCTCTTCATCGATGCATTCACCAGGG
AGCAGCTCGTACTACCACCATCAACAGGTCTCTTATCAGG
ACATCAAACCTTGTGTGATGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations